Rh1CG095200

Vesicle transport protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
Physical Location & Seq
Reverse (-)
20352328 .. 20353514
1187 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG095200.1

Sequence Viewer

Length: 384 bp
ATGGTTTCCTTCGAGATGAATGATCGGAAAAAGATCGGACTGGGATTGACAGGATTTGACGTATTTTTCTCATTCTTGGGAATGGTTTTTTTCTTTGACAAGGGATTACTTGCAATGGGAAATATCCTCTTCTTCTCAGGGGTGACTTTAACAAGGGATTATTGGAGTTATGTAGATACTTTTCACGAAGAGAAGAGCAAACGTGAAAGAAGAAAAGAAAACAAAGCTTTGACTATGGAATTGTTGGCTGTGGCATATTCGTCCCTTGTAGCCAAAATGGAGAAGATTATATATAGGTTGGTCATGCTGGAATTTTCGGCCACACAGAAGTATTCTCTTGCATCTAATTCAACTTACAATGTGGAAGAGGCTGGTGATCTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

127

Amino Acids

14.64

Weight (kDa)

6.59

Isoelectric Point (pI)

25.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 318
AcsI RAATTY 1 cut(s) 311
AgsI TTSAA 1 cut(s) 351
AluBI AGCT 1 cut(s) 227
AluI AGCT 1 cut(s) 227
AoxI GGCC 1 cut(s) 318
ApoI RAATTY 1 cut(s) 311
AsuHPI GGTGA 1 cut(s) 154
BmrI ACTGGG 1 cut(s) 50
BmsI GCATC 1 cut(s) 350
BmuI ACTGGG 1 cut(s) 50
Bse1I ACTGG 1 cut(s) 45
Bse3DI GCAATG 1 cut(s) 120
BseMI GCAATG 1 cut(s) 120
BseMII CTCAG 1 cut(s) 150
BseNI ACTGG 1 cut(s) 45
BshFI GGCC 1 cut(s) 320
BslFI GGGAC 1 cut(s) 247
BsmFI GGGAC 1 cut(s) 247
BsnI GGCC 1 cut(s) 320
Bsp143I GATC 3 cut(s) 22, 33, 376
BspANI GGCC 1 cut(s) 320
BspCNI CTCAG 1 cut(s) 149
BspQI GCTCTTC 1 cut(s) 188
BsrDI GCAATG 1 cut(s) 120
BsrI ACTGG 1 cut(s) 45
BssMI GATC 3 cut(s) 22, 33, 376
Bst6I CTCTTC 4 cut(s) 134, 183, 188, 360
BstDEI CTNAG 1 cut(s) 136
BstKTI GATC 3 cut(s) 25, 36, 379
BstMBI GATC 3 cut(s) 22, 33, 376
BsuRI GGCC 1 cut(s) 320
CviAII CATG 1 cut(s) 304
CviJI RGCY 5 cut(s) 227, 248, 272, 320, 371
CviKI_1 RGCY 5 cut(s) 227, 248, 272, 320, 371
DdeI CTNAG 1 cut(s) 136
DpnI GATC 3 cut(s) 24, 35, 378
DpnII GATC 3 cut(s) 22, 33, 376
EaeI YGGCCR 1 cut(s) 318
Eam1104I CTCTTC 4 cut(s) 134, 183, 188, 360
EarI CTCTTC 4 cut(s) 134, 183, 188, 360
FaeI CATG 1 cut(s) 307
FaiI YATR 7 cut(s) 171, 236, 256, 290, 292, 294, 305
FaqI GGGAC 1 cut(s) 247
FatI CATG 1 cut(s) 303
HaeIII GGCC 1 cut(s) 320
Hin1II CATG 1 cut(s) 307
HindIII AAGCTT 1 cut(s) 225
HphI GGTGA 1 cut(s) 154
Hpy188I TCNGA 2 cut(s) 27, 38
Hpy188III TCNNGA 2 cut(s) 13, 185
HpyAV CCTTC 1 cut(s) 19
HpyCH4IV ACGT 2 cut(s) 60, 202
HpyCH4V TGCA 2 cut(s) 113, 341
HpyF3I CTNAG 1 cut(s) 136
HpySE526I ACGT 2 cut(s) 60, 202
Hsp92II CATG 1 cut(s) 307
Kzo9I GATC 3 cut(s) 22, 33, 376
LguI GCTCTTC 1 cut(s) 188
LpnPI CCDG 5 cut(s) 26, 36, 123, 293, 357
LweI GCATC 1 cut(s) 350
MaeII ACGT 2 cut(s) 60, 202
MaeIII GTNAC 1 cut(s) 142
MalI GATC 3 cut(s) 24, 35, 378
MboI GATC 3 cut(s) 22, 33, 376
MboII GAAGA 7 cut(s) 121, 124, 200, 205, 222, 295, 377
MluCI AATT 3 cut(s) 239, 311, 346
MnlI CCTC 2 cut(s) 137, 361
MseI TTAA 1 cut(s) 149
NdeII GATC 3 cut(s) 22, 33, 376
NlaIII CATG 1 cut(s) 307
NmuCI GTSAC 1 cut(s) 142
PciSI GCTCTTC 1 cut(s) 188
SapI GCTCTTC 1 cut(s) 188
SaqAI TTAA 1 cut(s) 149
Sau3AI GATC 3 cut(s) 22, 33, 376
SetI ASST 4 cut(s) 63, 205, 229, 299
SfaNI GCATC 1 cut(s) 350
Sse9I AATT 3 cut(s) 239, 311, 346
TaiI ACGT 2 cut(s) 63, 205
TaqI TCGA 1 cut(s) 12
TasI AATT 3 cut(s) 239, 311, 346
Tru1I TTAA 1 cut(s) 149
Tru9I TTAA 1 cut(s) 149
TseFI GTSAC 1 cut(s) 142
Tsp45I GTSAC 1 cut(s) 142
TspDTI ATGAA 1 cut(s) 32
XapI RAATTY 1 cut(s) 311
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.