RchiOBHm_Chr5g0044941

Thylakoidal processing peptidase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
40433925 .. 40437064
3140 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ32308

Sequence Viewer

Length: 156 bp
ATGGTGAATGGTGAAATTCAAAATGAAAATTACATATTGGAGCCTCTTGCCTATGAAATGGAACCAATCCTGGAGCATCCAGTTTTTTTAACCAACTCCTGCAGCATTGCGGTTTTTCAATTGTTGTTTTTGCAAGTAGCTAAAGTTCTAATTTAA

Protein Analysis

51

Amino Acids

5.84

Weight (kDa)

4.2

Isoelectric Point (pI)

31.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 110
AcsI RAATTY 1 cut(s) 15
AgsI TTSAA 2 cut(s) 20, 119
AjnI CCWGG 1 cut(s) 69
AluBI AGCT 1 cut(s) 140
AluI AGCT 1 cut(s) 140
ApeKI GCWGC 1 cut(s) 102
ApoI RAATTY 1 cut(s) 15
AsuHPI GGTGA 2 cut(s) 16, 23
BbvI GCAGC 1 cut(s) 114
BciT130I CCWGG 1 cut(s) 71
BfmI CTRYAG 1 cut(s) 100
BisI GCNGC 1 cut(s) 103
BlsI GCNGC 1 cut(s) 104
Bme1390I CCNGG 1 cut(s) 71
BmiI GGNNCC 2 cut(s) 42, 63
BmrFI CCNGG 1 cut(s) 71
BmsI GCATC 1 cut(s) 85
BpmI CTGGAG 1 cut(s) 92
Bse1I ACTGG 1 cut(s) 80
Bse3DI GCAATG 1 cut(s) 105
BseBI CCWGG 1 cut(s) 71
BseGI GGATG 1 cut(s) 76
BseMI GCAATG 1 cut(s) 105
BseNI ACTGG 1 cut(s) 80
BseXI GCAGC 1 cut(s) 114
BspACI CCGC 1 cut(s) 110
BspLI GGNNCC 2 cut(s) 42, 63
BspMAI CTGCAG 1 cut(s) 104
BsrDI GCAATG 1 cut(s) 105
BsrI ACTGG 1 cut(s) 80
Bst2UI CCWGG 1 cut(s) 71
BstF5I GGATG 1 cut(s) 76
BstNI CCWGG 1 cut(s) 71
BstSCI CCNGG 1 cut(s) 69
BstSFI CTRYAG 1 cut(s) 100
BstV1I GCAGC 1 cut(s) 114
BtsCI GGATG 1 cut(s) 76
CviJI RGCY 2 cut(s) 43, 140
CviKI_1 RGCY 2 cut(s) 43, 140
EcoRII CCWGG 1 cut(s) 69
FaiI YATR 2 cut(s) 35, 54
Fnu4HI GCNGC 1 cut(s) 103
FokI GGATG 1 cut(s) 63
Fsp4HI GCNGC 1 cut(s) 103
GluI GCNGC 1 cut(s) 103
GsuI CTGGAG 1 cut(s) 92
HphI GGTGA 2 cut(s) 16, 23
HpyCH4V TGCA 2 cut(s) 102, 133
LmnI GCTCC 2 cut(s) 40, 73
LpnPI CCDG 4 cut(s) 56, 83, 93, 112
Lsp1109I GCAGC 1 cut(s) 114
LweI GCATC 1 cut(s) 85
MfeI CAATTG 1 cut(s) 119
MluCI AATT 4 cut(s) 15, 28, 119, 150
MnlI CCTC 1 cut(s) 54
MseI TTAA 2 cut(s) 89, 154
MspR9I CCNGG 1 cut(s) 71
MunI CAATTG 1 cut(s) 119
MvaI CCWGG 1 cut(s) 71
NlaIV GGNNCC 2 cut(s) 42, 63
PfoI TCCNGGA 1 cut(s) 69
PkrI GCNGC 1 cut(s) 104
Psp6I CCWGG 1 cut(s) 69
PspGI CCWGG 1 cut(s) 69
PspN4I GGNNCC 2 cut(s) 42, 63
PsrI GAACNNNNNNTAC 1 cut(s) 129
PstI CTGCAG 1 cut(s) 104
SaqAI TTAA 2 cut(s) 89, 154
SatI GCNGC 1 cut(s) 103
ScrFI CCNGG 1 cut(s) 71
SetI ASST 1 cut(s) 142
SfaNI GCATC 1 cut(s) 85
SfcI CTRYAG 1 cut(s) 100
SgeI CNNG 6 cut(s) 59, 82, 83, 92, 111, 146
Sse9I AATT 4 cut(s) 15, 28, 119, 150
SsiI CCGC 1 cut(s) 110
StyD4I CCNGG 1 cut(s) 69
TasI AATT 4 cut(s) 15, 28, 119, 150
Tru1I TTAA 2 cut(s) 89, 154
Tru9I TTAA 2 cut(s) 89, 154
TseI GCWGC 1 cut(s) 102
TspDTI ATGAA 2 cut(s) 39, 69
XapI RAATTY 1 cut(s) 15
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.