RchiOBHm_Chr5g0083671

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
89347903 .. 89348720
818 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ35779

Sequence Viewer

Length: 171 bp
ATGTTGTTACTAATCAGACAACACAATATTTTGAACTTATACAGGGCACTCCACAGAGGTGCACTCTCTTTGTTGGGATACAAATGTGGCTTCGGTCAGTCAAGAGTCTGTCAGAGTGTGGTCATTAGTCCTCTGGAAAGTGCATTCACAAGCTCAATACTATCTCCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

56

Amino Acids

6.17

Weight (kDa)

9.84

Isoelectric Point (pI)

65.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 34
AleI CACNNNNGTG 1 cut(s) 57
AluBI AGCT 1 cut(s) 153
AluI AGCT 1 cut(s) 153
Alw21I GWGCWC 1 cut(s) 64
Alw44I GTGCAC 1 cut(s) 60
ApaLI GTGCAC 1 cut(s) 60
BaeGI GKGCMC 2 cut(s) 49, 64
BaeI ACNNNNGTAYC 2 cut(s) 70, 103
Bbv12I GWGCWC 1 cut(s) 64
BciVI GTATCC 1 cut(s) 71
BfuI GTATCC 1 cut(s) 71
BplI GAGNNNNNCTC 2 cut(s) 48, 80
BseSI GKGCMC 2 cut(s) 49, 64
BsiHKAI GWGCWC 1 cut(s) 64
BsmI GAATGC 1 cut(s) 143
Bsp1286I GDGCHC 2 cut(s) 49, 64
BstSLI GKGCMC 2 cut(s) 49, 64
BsuI GTATCC 1 cut(s) 71
CviJI RGCY 2 cut(s) 90, 153
CviKI_1 RGCY 2 cut(s) 90, 153
FaiI YATR 2 cut(s) 40, 169
HinfI GANTC 1 cut(s) 105
Hpy166II GTNNAC 1 cut(s) 62
Hpy188I TCNGA 2 cut(s) 17, 114
Hpy188III TCNNGA 2 cut(s) 102, 134
Hpy8I GTNNAC 1 cut(s) 62
HpyCH4V TGCA 2 cut(s) 62, 143
LpnPI CCDG 2 cut(s) 28, 119
MaeIII GTNAC 1 cut(s) 6
MhlI GDGCHC 2 cut(s) 49, 64
MlyI GAGTC 1 cut(s) 114
MnlI CCTC 2 cut(s) 50, 141
MslI CAYNNNNRTG 1 cut(s) 57
Mva1269I GAATGC 1 cut(s) 143
OliI CACNNNNGTG 1 cut(s) 57
PctI GAATGC 1 cut(s) 143
PleI GAGTC 1 cut(s) 113
PpsI GAGTC 1 cut(s) 113
RseI CAYNNNNRTG 1 cut(s) 57
SchI GAGTC 1 cut(s) 114
SduI GDGCHC 2 cut(s) 49, 64
SetI ASST 2 cut(s) 61, 155
SgeI CNNG 4 cut(s) 55, 114, 146, 162
SmiMI CAYNNNNRTG 1 cut(s) 57
SspI AATATT 1 cut(s) 28
TaqII GACCGA 1 cut(s) 83
VneI GTGCAC 1 cut(s) 60
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.