Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr2D

Orthogroup ID

OG0009720

Physical Location & Seq

Genomic Coordinates Reverse (-)

52020505 .. 52021255

Gene Structure 751 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh2DG367700.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 225 bp

ATGCTGAGAGTGATAGGTAGACACATTCACTGCAGGGCACTCCACAGAATTGCACTCTCTTTGTTGGGATACAAATGTGGCTTCGGTCATTTTATAATTGTCCTACATTTAGAAACTCTAGAAGCTGAGATTAAGATGCTCAGGAAGAAGCTGACCTTTAAAGCAACTCCAATGCCTAACGCTGATCTCTTTCTGATATCTCTAGGTAGTTGTTCAAGTCTGTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0005488 GO:0005515 GO:0008017 GO:0008092 GO:0008150 GO:0009719 GO:0009723 GO:0009725 GO:0009987 GO:0010033 GO:0015631 GO:0032870 GO:0042221 GO:0050896 GO:0051716 GO:0070887 GO:0071310 GO:0071369 GO:0071495

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

TPX2

Protein Analysis

74

Amino Acids

8.35

Weight (kDa)

9.81

Isoelectric Point (pI)

36.71

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
TPX2	PF06886	38 - 60	1.3e-06	Targeting protein for Xklp2 (TPX2) domain

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009720)

Species	Orthologous Gene IDs
malus_domestica	MD03G1148400.v1.1 MD05G1175700.v1.1 MD10G1012100.v1.1
pyrus_communis	pycom03g10260 pycom05g16230
rosa_chinensis	RchiOBHm_Chr1g0330921 RchiOBHm_Chr1g0356631 RchiOBHm_Chr5g0083671
rosa_laevigata	RLG00000008846
rosa_multiflora	Rmu_sc0000650.1_g000020
rosa_roxburghii	Rroxscaffold_2G00114950 Rroxscaffold_2G00138200 Rroxscaffold_3G00218770 Rroxscaffold_3G00224400 Rroxscaffold_3G00276410 Rroxscaffold_4G00325870 Rroxscaffold_7G00196860
rosa_samantha	Rh1CG247500 Rh2DG367700 Rh3CG314600 Rh7BG472300 Rh7DG486100

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	95
AccI	GTMKAC	1 cut(s)	19
AgsI	TTSAA	1 cut(s)	216
AluBI	AGCT	2 cut(s)	125, 151
AluI	AGCT	2 cut(s)	125, 151
BaeGI	GKGCMC	1 cut(s)	40
BaeI	ACNNNNGTAYC	2 cut(s)	61, 94
BciVI	GTATCC	1 cut(s)	62
BfaI	CTAG	2 cut(s)	119, 203
BfmI	CTRYAG	2 cut(s)	31, 221
BfuI	GTATCC	1 cut(s)	62
BmsI	GCATC	1 cut(s)	126
Bpu10I	CCTNAGC	1 cut(s)	140
BseMII	CTCAG	2 cut(s)	117, 154
BseSI	GKGCMC	1 cut(s)	40
Bsp1286I	GDGCHC	1 cut(s)	40
Bsp143I	GATC	1 cut(s)	184
BspCNI	CTCAG	2 cut(s)	118, 153
BspMAI	CTGCAG	1 cut(s)	35
BssMI	GATC	1 cut(s)	184
BstDEI	CTNAG	3 cut(s)	5, 126, 140
BstKTI	GATC	1 cut(s)	187
BstMBI	GATC	1 cut(s)	184
BstSFI	CTRYAG	2 cut(s)	31, 221
BstSLI	GKGCMC	1 cut(s)	40
BsuI	GTATCC	1 cut(s)	62
BtsI	GCAGTG	1 cut(s)	28
BtsIMutI	CAGTG	1 cut(s)	28
CviJI	RGCY	3 cut(s)	81, 125, 151
CviKI_1	RGCY	3 cut(s)	81, 125, 151
DdeI	CTNAG	3 cut(s)	5, 126, 140
DpnI	GATC	1 cut(s)	186
DpnII	GATC	1 cut(s)	184
DraI	TTTAAA	1 cut(s)	160
Eco32I	GATATC	1 cut(s)	198
EcoRV	GATATC	1 cut(s)	198
FaiI	YATR	1 cut(s)	95
FalI	AAGNNNNNCTT	2 cut(s)	140, 172
FblI	GTMKAC	1 cut(s)	19
FspBI	CTAG	2 cut(s)	119, 203
Hpy166II	GTNNAC	1 cut(s)	20
Hpy188I	TCNGA	1 cut(s)	195
Hpy188III	TCNNGA	2 cut(s)	119, 142
Hpy8I	GTNNAC	1 cut(s)	20
HpyCH4V	TGCA	2 cut(s)	33, 53
HpyF3I	CTNAG	3 cut(s)	5, 126, 140
Kzo9I	GATC	1 cut(s)	184
LpnPI	CCDG	2 cut(s)	19, 127
LweI	GCATC	1 cut(s)	126
MaeI	CTAG	2 cut(s)	119, 203
MalI	GATC	1 cut(s)	186
MboI	GATC	1 cut(s)	184
MboII	GAAGA	1 cut(s)	157
MhlI	GDGCHC	1 cut(s)	40
MluCI	AATT	2 cut(s)	48, 96
MseI	TTAA	2 cut(s)	132, 159
NdeII	GATC	1 cut(s)	184
PsiI	TTATAA	1 cut(s)	95
PstI	CTGCAG	1 cut(s)	35
SaqAI	TTAA	2 cut(s)	132, 159
Sau3AI	GATC	1 cut(s)	184
SduI	GDGCHC	1 cut(s)	40
SetI	ASST	5 cut(s)	19, 127, 153, 158, 208
SfaNI	GCATC	1 cut(s)	126
SfcI	CTRYAG	2 cut(s)	31, 221
SgeI	CNNG	4 cut(s)	46, 131, 154, 215
Sse9I	AATT	2 cut(s)	48, 96
SspMI	CTAG	2 cut(s)	119, 203
TaqII	GACCGA	1 cut(s)	74
TasI	AATT	2 cut(s)	48, 96
Tru1I	TTAA	2 cut(s)	132, 159
Tru9I	TTAA	2 cut(s)	132, 159
TscAI	CASTG	1 cut(s)	35
TspRI	CASTG	1 cut(s)	35
XbaI	TCTAGA	1 cut(s)	118
XmiI	GTMKAC	1 cut(s)	19
XspI	CTAG	2 cut(s)	119, 203

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.