RchiOBHm_Chr6g0253221

sulfhydryl oxidase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
OG0009180
Physical Location & Seq
Forward (+)
8355160 .. 8357826
2667 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ22705

Sequence Viewer

Length: 417 bp
ATGATTCCACCCATCTCCAACCCCAAGATCTCATCATTCTCATCAACAAGAGTGGGGAAATTGGCTGGTCCTGTGACGAAAGAAGGGCTCGGAAGATCCACTTGGACTTTTCTTCACACTCTTGCTGCTCAGTATCCAGATAATCCAACGAGGCAACAGAAGGACGTAAAAGAATTGATGTCAATATTATCACAAATGTACCCTTGCAAGGAATGTGCAGATCATTTTTCAAGAAATTCTAAGGCTGGATCTCATGCTGAATTCTCCCAGAGGCTATGTCATGTGCATAATACTGTTAACAGAAGCTTTAACAAAGTGGTTTTCCCTTGTGAACGTGTTGATGCAAGGTGGGGCAAGTTAGAGTGTGAACAGCATGCTTGCGATGTACTAGGAAGTACCGCAAGTTTTTGGAAATAG

Protein Analysis

138

Amino Acids

15.53

Weight (kDa)

9.15

Isoelectric Point (pI)

47.92

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Evr1_Alr PF04777 32 - 117 2.1e-25 Erv1 / Alr family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 399
AclWI GGATC 2 cut(s) 90, 256
AcsI RAATTY 2 cut(s) 235, 260
AfaI GTAC 3 cut(s) 200, 387, 397
AfiI CCNNNNNNNGG 1 cut(s) 208
AflIII ACRYGT 1 cut(s) 334
AgsI TTSAA 1 cut(s) 231
AjuI GAANNNNNNNTTGG 2 cut(s) 85, 117
AluBI AGCT 1 cut(s) 306
AluI AGCT 1 cut(s) 306
AlwI GGATC 2 cut(s) 90, 256
ApeKI GCWGC 1 cut(s) 125
ApoI RAATTY 2 cut(s) 235, 260
AspS9I GGNCC 1 cut(s) 68
AvaII GGWCC 1 cut(s) 68
BaeI ACNNNNGTAYC 2 cut(s) 182, 215
BanII GRGCYC 1 cut(s) 90
BbvI GCAGC 1 cut(s) 112
BccI CCATC 1 cut(s) 20
BciVI GTATCC 1 cut(s) 144
BfaI CTAG 1 cut(s) 389
BfuI GTATCC 1 cut(s) 144
BglII AGATCT 1 cut(s) 27
BisI GCNGC 1 cut(s) 126
BlsI GCNGC 1 cut(s) 127
Bme18I GGWCC 1 cut(s) 68
BmgT120I GGNCC 1 cut(s) 68
BmsI GCATC 1 cut(s) 331
Bsc4I CCNNNNNNNGG 1 cut(s) 208
BseLI CCNNNNNNNGG 1 cut(s) 208
BseMII CTCAG 1 cut(s) 143
BseXI GCAGC 1 cut(s) 112
BsgI GTGCAG 1 cut(s) 237
BslI CCNNNNNNNGG 1 cut(s) 208
Bsp1286I GDGCHC 1 cut(s) 90
Bsp143I GATC 4 cut(s) 27, 95, 220, 248
BspACI CCGC 1 cut(s) 399
BspCNI CTCAG 1 cut(s) 142
BspPI GGATC 2 cut(s) 90, 256
BssMI GATC 4 cut(s) 27, 95, 220, 248
Bst4CI ACNGT 1 cut(s) 295
BstC8I GCNNGC 2 cut(s) 375, 379
BstDEI CTNAG 2 cut(s) 129, 240
BstKTI GATC 4 cut(s) 30, 98, 223, 251
BstMBI GATC 4 cut(s) 27, 95, 220, 248
BstNSI RCATGY 1 cut(s) 377
BstV1I GCAGC 1 cut(s) 112
BstX2I RGATCY 3 cut(s) 27, 95, 248
BstYI RGATCY 3 cut(s) 27, 95, 248
BsuI GTATCC 1 cut(s) 144
BtgZI GCGATG 1 cut(s) 396
Cac8I GCNNGC 2 cut(s) 375, 379
Cfr13I GGNCC 1 cut(s) 68
Csp6I GTAC 3 cut(s) 199, 386, 396
CspCI CAANNNNNGTGG 2 cut(s) 33, 68
CviAII CATG 3 cut(s) 254, 281, 374
CviJI RGCY 5 cut(s) 65, 88, 245, 274, 306
CviKI_1 RGCY 5 cut(s) 65, 88, 245, 274, 306
CviQI GTAC 3 cut(s) 199, 386, 396
DdeI CTNAG 2 cut(s) 129, 240
DpnI GATC 4 cut(s) 29, 97, 222, 250
DpnII GATC 4 cut(s) 27, 95, 220, 248
Eco24I GRGCYC 1 cut(s) 90
Eco47I GGWCC 1 cut(s) 68
EcoRI GAATTC 1 cut(s) 260
EcoT38I GRGCYC 1 cut(s) 90
FaeI CATG 3 cut(s) 257, 284, 377
FaiI YATR 5 cut(s) 255, 277, 282, 288, 375
FalI AAGNNNNNCTT 2 cut(s) 85, 117
FatI CATG 3 cut(s) 253, 280, 373
Fnu4HI GCNGC 1 cut(s) 126
FriOI GRGCYC 1 cut(s) 90
Fsp4HI GCNGC 1 cut(s) 126
FspBI CTAG 1 cut(s) 389
GluI GCNGC 1 cut(s) 126
Hin1II CATG 3 cut(s) 257, 284, 377
HincII GTYRAC 1 cut(s) 298
HindII GTYRAC 1 cut(s) 298
HindIII AAGCTT 1 cut(s) 304
HinfI GANTC 1 cut(s) 4
HpaI GTTAAC 1 cut(s) 298
Hpy166II GTNNAC 3 cut(s) 298, 332, 368
Hpy188I TCNGA 1 cut(s) 92
Hpy188III TCNNGA 2 cut(s) 137, 231
Hpy8I GTNNAC 3 cut(s) 298, 332, 368
HpyAV CCTTC 2 cut(s) 77, 154
HpyCH4III ACNGT 1 cut(s) 295
HpyCH4IV ACGT 2 cut(s) 165, 334
HpyCH4V TGCA 4 cut(s) 207, 218, 286, 344
HpyF3I CTNAG 2 cut(s) 129, 240
HpySE526I ACGT 2 cut(s) 165, 334
Hsp92II CATG 3 cut(s) 257, 284, 377
KspAI GTTAAC 1 cut(s) 298
Kzo9I GATC 4 cut(s) 27, 95, 220, 248
LpnPI CCDG 5 cut(s) 51, 84, 150, 231, 281
Lsp1109I GCAGC 1 cut(s) 112
LweI GCATC 1 cut(s) 331
MaeI CTAG 1 cut(s) 389
MaeII ACGT 2 cut(s) 165, 334
MaeIII GTNAC 1 cut(s) 73
MalI GATC 4 cut(s) 29, 97, 222, 250
MboI GATC 4 cut(s) 27, 95, 220, 248
MboII GAAGA 2 cut(s) 104, 105
MflI RGATCY 3 cut(s) 27, 95, 248
MhlI GDGCHC 1 cut(s) 90
MluCI AATT 4 cut(s) 59, 173, 235, 260
MmeI TCCRAC 2 cut(s) 42, 170
MnlI CCTC 2 cut(s) 144, 264
MseI TTAA 2 cut(s) 297, 309
NdeII GATC 4 cut(s) 27, 95, 220, 248
NlaIII CATG 3 cut(s) 257, 284, 377
NmuCI GTSAC 1 cut(s) 73
NspI RCATGY 1 cut(s) 377
PaeI GCATGC 1 cut(s) 377
PfeI GAWTC 1 cut(s) 4
PkrI GCNGC 1 cut(s) 127
PspPI GGNCC 1 cut(s) 68
PsuI RGATCY 3 cut(s) 27, 95, 248
RsaI GTAC 3 cut(s) 200, 387, 397
RsaNI GTAC 3 cut(s) 199, 386, 396
SaqAI TTAA 2 cut(s) 297, 309
SatI GCNGC 1 cut(s) 126
Sau3AI GATC 4 cut(s) 27, 95, 220, 248
Sau96I GGNCC 1 cut(s) 68
SduI GDGCHC 1 cut(s) 90
SetI ASST 4 cut(s) 168, 308, 337, 350
SfaNI GCATC 1 cut(s) 331
SinI GGWCC 1 cut(s) 68
SphI GCATGC 1 cut(s) 377
Sse9I AATT 4 cut(s) 59, 173, 235, 260
SsiI CCGC 1 cut(s) 399
SspI AATATT 1 cut(s) 186
SspMI CTAG 1 cut(s) 389
TaaI ACNGT 1 cut(s) 295
TaiI ACGT 2 cut(s) 168, 337
TasI AATT 4 cut(s) 59, 173, 235, 260
TatI WGTACW 1 cut(s) 385
TfiI GAWTC 1 cut(s) 4
Tru1I TTAA 2 cut(s) 297, 309
Tru9I TTAA 2 cut(s) 297, 309
TseFI GTSAC 1 cut(s) 73
TseI GCWGC 1 cut(s) 125
Tsp45I GTSAC 1 cut(s) 73
VpaK11BI GGWCC 1 cut(s) 68
XapI RAATTY 2 cut(s) 235, 260
XceI RCATGY 1 cut(s) 377
XspI CTAG 1 cut(s) 389
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.