Rorug05G0542900

Transcriptional regulator of RNA polII, SAGA, subunit

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
OG0000538
Physical Location & Seq
Forward (+)
73111766 .. 73114784
3019 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0542900.1

Sequence Viewer

Length: 681 bp
ATGGGGGCTGTAGTGGGAAAGGCCAATAGTGGGAGTCTTTCGATATCTGAAACAAAGCTGGAAGCCAAAATGGTTGAAGCTATGCAGCGAAGAGCAGCTAAAGGAAGTGTCATGAAATCATTCAACAGCATAATCTTGAAGTTCCCAAAGATTGATGAGAGCTTAAGAAATTGCAAAGATATTTTTCAGCAGTTTGATGAGGATTCAAATGGCATCATTGATCATGATGAATTGAAAAGAGCTTTCTCAAAACTGGAAGTCTCGTTTACAGATGAGGAAATCGATGATCTCTTTGCAGCATGCGATATTAATGAGGATATGGGAATCAAGTTTAATGAGTTCATCGTTCTTATTTGCGTTGTCTTTCTTCTGAAGGATGATCAGAATGCTGGGCAAAAAAAAGTGGATATGGGAATGCCAAAGCTGGAGGCCACCTTCGAAACATTGGTGGATGCATTTGTGTTCTTGGATAAGAACAAGGATGGTTATGTCAGCAAGAGTGAAATGGTTCAGTCCATTAATGAAACTACAACAGGAGAACGCTCCTCTGGGCGAATAGCCATGAAAAGATTTGAAGAGATGGACTGGGATAAAAATGGAATGGTGAACTTCAAGGAGTTCCTTTTTGCATTCACTCGATGGATTGGAATTGACGATCTTGAGGATGAGGATGAAGACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
SAGA-Tad1

Protein Analysis

226

Amino Acids

25.69

Weight (kDa)

4.55

Isoelectric Point (pI)

32.99

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
EF-hand_7 PF13499 58 - 115 9.1e-10 EF-hand domain pair
EF-hand_1 PF00036 58 - 85 3.7e-06 EF hand domain
EF-hand_6 PF13405 59 - 84 8.7e-06 EF-hand domain
EF-hand_8 PF13833 69 - 117 1.6e-06 EF-hand domain pair
EF-hand_7 PF13499 147 - 211 5e-08 EF-hand domain pair
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000538)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g04050 FvH4_2g04050 FvH4_2g04050 FvH4_2g04050 FvH4_2g04050
rosa_chinensis RchiOBHm_Chr6g0253231 RchiOBHm_Chr6g0253251 RchiOBHm_Chr6g0253261 RchiOBHm_Chr6g0253271 RchiOBHm_Chr6g0253291 RchiOBHm_Chr6g0253321 RchiOBHm_Chr6g0253331 RchiOBHm_Chr6g0253341 RchiOBHm_Chr6g0253371 RchiOBHm_Chr6g0253401
rosa_laevigata RLG00000015022 RLG00000015023 RLG00000015024 RLG00000015027 RLG00000015028 RLG00000015030 RLG00000015031 RLG00000015034 RLG00000015035 RLG00000015038 RLG00000015041
rosa_multiflora Rmu_sc0001257.1_g000004 Rmu_sc0001257.1_g000008 Rmu_sc0001257.1_g000014 Rmu_sc0001257.1_g000016 Rmu_sc0001257.1_g000019 Rmu_sc0001257.1_g000026 Rmu_sc0002560.1_g000013 Rmu_sc0002560.1_g000020 Rmu_sc0002560.1_g000021 Rmu_sc0003855.1_g000005 Rmu_sc0003855.1_g000011 Rmu_sc0003898.1_g000003 Rmu_sc0003898.1_g000005 Rmu_sc0003898.1_g000016 Rmu_sc0003898.1_g000017 Rmu_sc0005439.1_g000007 Rmu_sc0005439.1_g000014 Rmu_sc0005439.1_g000021
rosa_roxburghii Rroxscaffold_7G00211930 Rroxscaffold_7G00211940 Rroxscaffold_7G00211960 Rroxscaffold_7G00211980 Rroxscaffold_7G00211990 Rroxscaffold_7G00212000 Rroxscaffold_7G00212050 Rroxscaffold_7G00212060 Rroxscaffold_7G00212070 Rroxscaffold_7G00212080 Rroxscaffold_7G00212160
rosa_rugosa Rorug05G0542900 Rorug05G0542900 Rorug05G0543000 Rorug05G0543100 Rorug05G0543100 Rorug05G0543200 Rorug05G0543300 Rorug05G0543400 Rorug05G0543400 Rorug05G0543500 Rorug05G0543600 Rorug05G0543700
rosa_samantha Rh6CG050000 Rh6DG045200 Rh6DG045500 Rh6DG045600 Rh6DG045700 Rh6DG045800 Rh6DG046200 Rh6DG046300 Rh6DG046400 Rh6DG046500 Rh6DG046700 Rh6DG046800
rosa_wichuraiana Rw0G000070 Rw6G005230 Rw6G005240 Rw6G005280 Rw6G005290

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 392
AfiI CCNNNNNNNGG 1 cut(s) 30
AflII CTTAAG 1 cut(s) 163
AgsI TTSAA 7 cut(s) 77, 124, 139, 207, 235, 575, 613
AluBI AGCT 6 cut(s) 58, 80, 98, 162, 242, 424
AluI AGCT 6 cut(s) 58, 80, 98, 162, 242, 424
Alw26I GTCTC 1 cut(s) 265
AoxI GGCC 2 cut(s) 21, 429
ApeKI GCWGC 3 cut(s) 85, 95, 296
AseI ATTAAT 2 cut(s) 309, 519
Asp700I GAANNNNTTC 2 cut(s) 119, 507
AsuHPI GGTGA 1 cut(s) 616
AsuII TTCGAA 1 cut(s) 438
BbvI GCAGC 3 cut(s) 97, 107, 308
BccI CCATC 3 cut(s) 476, 574, 633
BclI TGATCA 2 cut(s) 220, 379
BcoDI GTCTC 1 cut(s) 265
BfmI CTRYAG 1 cut(s) 9
BfrI CTTAAG 1 cut(s) 163
BisI GCNGC 3 cut(s) 86, 96, 297
BlsI GCNGC 3 cut(s) 87, 97, 298
BmrI ACTGGG 1 cut(s) 595
BmsI GCATC 2 cut(s) 222, 442
BmuI ACTGGG 1 cut(s) 595
BpmI CTGGAG 1 cut(s) 446
Bpu14I TTCGAA 1 cut(s) 438
BpuEI CTTGAG 1 cut(s) 680
Bsa29I ATCGAT 1 cut(s) 282
Bsc4I CCNNNNNNNGG 1 cut(s) 30
Bse1I ACTGG 2 cut(s) 258, 590
BseCI ATCGAT 1 cut(s) 282
BseGI GGATG 5 cut(s) 382, 457, 487, 670, 676
BseLI CCNNNNNNNGG 1 cut(s) 30
BseNI ACTGG 2 cut(s) 258, 590
BseRI GAGGAG 1 cut(s) 535
BseXI GCAGC 3 cut(s) 97, 107, 308
BseYI CCCAGC 1 cut(s) 389
BshFI GGCC 2 cut(s) 23, 431
BshVI ATCGAT 1 cut(s) 282
BslI CCNNNNNNNGG 1 cut(s) 30
BsmAI GTCTC 1 cut(s) 265
BsmI GAATGC 3 cut(s) 391, 420, 629
BsnI GGCC 2 cut(s) 23, 431
Bsp119I TTCGAA 1 cut(s) 438
Bsp143I GATC 4 cut(s) 220, 286, 379, 655
BspANI GGCC 2 cut(s) 23, 431
BspDI ATCGAT 1 cut(s) 282
BspHI TCATGA 2 cut(s) 111, 223
BspQI GCTCTTC 1 cut(s) 85
BspT104I TTCGAA 1 cut(s) 438
BspTI CTTAAG 1 cut(s) 163
BsrI ACTGG 2 cut(s) 258, 590
BssMI GATC 4 cut(s) 220, 286, 379, 655
Bst6I CTCTTC 2 cut(s) 85, 570
BstAFI CTTAAG 1 cut(s) 163
BstBI TTCGAA 1 cut(s) 438
BstC8I GCNNGC 1 cut(s) 301
BstF5I GGATG 5 cut(s) 382, 457, 487, 670, 676
BstKTI GATC 4 cut(s) 223, 289, 382, 658
BstMAI GTCTC 1 cut(s) 265
BstMBI GATC 4 cut(s) 220, 286, 379, 655
BstNSI RCATGY 1 cut(s) 303
BstSFI CTRYAG 1 cut(s) 9
BstV1I GCAGC 3 cut(s) 97, 107, 308
Bsu15I ATCGAT 1 cut(s) 282
BsuRI GGCC 2 cut(s) 23, 431
BsuTUI ATCGAT 1 cut(s) 282
BtsCI GGATG 5 cut(s) 382, 457, 487, 670, 676
Cac8I GCNNGC 1 cut(s) 301
CciI TCATGA 2 cut(s) 111, 223
ClaI ATCGAT 1 cut(s) 282
CviAII CATG 4 cut(s) 112, 224, 300, 562
DpnI GATC 4 cut(s) 222, 288, 381, 657
DpnII GATC 4 cut(s) 220, 286, 379, 655
Eam1104I CTCTTC 2 cut(s) 85, 570
EarI CTCTTC 2 cut(s) 85, 570
Eco32I GATATC 1 cut(s) 45
Eco57I CTGAAG 1 cut(s) 392
EcoRV GATATC 1 cut(s) 45
EcoT22I ATGCAT 1 cut(s) 457
FaeI CATG 4 cut(s) 115, 227, 303, 565
FaiI YATR 9 cut(s) 83, 113, 131, 225, 301, 320, 410, 489, 563
FatI CATG 4 cut(s) 111, 223, 299, 561
FbaI TGATCA 2 cut(s) 220, 379
Fnu4HI GCNGC 3 cut(s) 86, 96, 297
FokI GGATG 4 cut(s) 389, 464, 494, 677
Fsp4HI GCNGC 3 cut(s) 86, 96, 297
GluI GCNGC 3 cut(s) 86, 96, 297
GsaI CCCAGC 1 cut(s) 393
GsuI CTGGAG 1 cut(s) 446
HaeIII GGCC 2 cut(s) 23, 431
Hin1II CATG 4 cut(s) 115, 227, 303, 565
HinfI GANTC 3 cut(s) 34, 203, 324
HphI GGTGA 1 cut(s) 616
Hpy166II GTNNAC 2 cut(s) 267, 607
Hpy188I TCNGA 3 cut(s) 49, 372, 384
Hpy188III TCNNGA 4 cut(s) 112, 136, 224, 659
Hpy8I GTNNAC 2 cut(s) 267, 607
HpyAV CCTTC 2 cut(s) 367, 445
HpyCH4V TGCA 5 cut(s) 85, 174, 296, 455, 629
Hsp92II CATG 4 cut(s) 115, 227, 303, 565
Ksp22I TGATCA 2 cut(s) 220, 379
Kzo9I GATC 4 cut(s) 220, 286, 379, 655
LguI GCTCTTC 1 cut(s) 85
LmnI GCTCC 1 cut(s) 548
LpnPI CCDG 7 cut(s) 44, 239, 375, 410, 519, 534, 571
Lsp1109I GCAGC 3 cut(s) 97, 107, 308
LweI GCATC 2 cut(s) 222, 442
MalI GATC 4 cut(s) 222, 288, 381, 657
MboI GATC 4 cut(s) 220, 286, 379, 655
MboII GAAGA 3 cut(s) 102, 359, 587
MluCI AATT 3 cut(s) 169, 230, 648
MlyI GAGTC 1 cut(s) 43
MnlI CCTC 7 cut(s) 193, 268, 307, 421, 556, 655, 661
Mph1103I ATGCAT 1 cut(s) 457
MroXI GAANNNNTTC 2 cut(s) 119, 507
MseI TTAA 4 cut(s) 164, 309, 333, 519
MspCI CTTAAG 1 cut(s) 163
Mva1269I GAATGC 3 cut(s) 391, 420, 629
NdeII GATC 4 cut(s) 220, 286, 379, 655
NlaIII CATG 4 cut(s) 115, 227, 303, 565
NsiI ATGCAT 1 cut(s) 457
NspI RCATGY 1 cut(s) 303
NspV TTCGAA 1 cut(s) 438
PaeI GCATGC 1 cut(s) 303
PagI TCATGA 2 cut(s) 111, 223
PciSI GCTCTTC 1 cut(s) 85
PctI GAATGC 3 cut(s) 391, 420, 629
PdmI GAANNNNTTC 2 cut(s) 119, 507
PfeI GAWTC 2 cut(s) 203, 324
PkrI GCNGC 3 cut(s) 87, 97, 298
PleI GAGTC 1 cut(s) 42
PpsI GAGTC 1 cut(s) 42
PshBI ATTAAT 2 cut(s) 309, 519
PspFI CCCAGC 1 cut(s) 389
SapI GCTCTTC 1 cut(s) 85
SaqAI TTAA 4 cut(s) 164, 309, 333, 519
SatI GCNGC 3 cut(s) 86, 96, 297
Sau3AI GATC 4 cut(s) 220, 286, 379, 655
SchI GAGTC 1 cut(s) 43
SetI ASST 7 cut(s) 60, 82, 100, 164, 244, 426, 437
SfaNI GCATC 2 cut(s) 222, 442
SfcI CTRYAG 1 cut(s) 9
SfuI TTCGAA 1 cut(s) 438
SmlI CTYRAG 2 cut(s) 163, 659
SmoI CTYRAG 2 cut(s) 163, 659
SphI GCATGC 1 cut(s) 303
Sse9I AATT 3 cut(s) 169, 230, 648
TaqI TCGA 4 cut(s) 41, 282, 438, 637
TasI AATT 3 cut(s) 169, 230, 648
TfiI GAWTC 2 cut(s) 203, 324
Tru1I TTAA 4 cut(s) 164, 309, 333, 519
Tru9I TTAA 4 cut(s) 164, 309, 333, 519
TseI GCWGC 3 cut(s) 85, 95, 296
TspDTI ATGAA 5 cut(s) 128, 243, 331, 537, 578
Vha464I CTTAAG 1 cut(s) 163
VspI ATTAAT 2 cut(s) 309, 519
XceI RCATGY 1 cut(s) 303
XmnI GAANNNNTTC 2 cut(s) 119, 507
Zsp2I ATGCAT 1 cut(s) 457
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.