Rroxscaffold_7G00212060

histone deacetylase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
OG0000538
Physical Location & Seq
Forward (+)
62509185 .. 62509774
590 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00212060.1

Sequence Viewer

Length: 459 bp
ATGGATGCCAAGCCATTTGACGCTAATTCCTGCCCATCAGAATTGAAGGCTGACCTTTCATCATTAAGAGGTAATCTTCCAAAGGAAACCTCTGCTTTTATTCAAGCTAGAAATGAGTTGAAGGTGGCCTCAGACCTAGCAGCTTCAATTACTCTAAAGAAGTTTGTTCTCCAACAAGAGTCTTCCAAGTATACCGATGCAAAGAAAGAAATTCTTGCCTCAGAGGAGAAAATTGCCAACCTTAAGGCTACTCTAGCAACAGAACAAAGCAAGAAGGCAAAGTTTGATGAGGTTTTGGATTCGATCGAGACTCGATTAACCTCTGCCAAAGATGGATTGCTCTCGGACTTAGCACAAGTGTCTAGCATGGAGGGAAGAGTCCAAGCTGCTAACCAGTTAGTATCTCAGCTACAATCGGTGTGGAATAGCTTAAGGACAACCTTTACGAAGTTTGCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
zf-UBP

Protein Analysis

152

Amino Acids

16.63

Weight (kDa)

7.77

Isoelectric Point (pI)

49.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000538)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g04050 FvH4_2g04050 FvH4_2g04050 FvH4_2g04050 FvH4_2g04050
rosa_chinensis RchiOBHm_Chr6g0253231 RchiOBHm_Chr6g0253251 RchiOBHm_Chr6g0253261 RchiOBHm_Chr6g0253271 RchiOBHm_Chr6g0253291 RchiOBHm_Chr6g0253321 RchiOBHm_Chr6g0253331 RchiOBHm_Chr6g0253341 RchiOBHm_Chr6g0253371 RchiOBHm_Chr6g0253401
rosa_laevigata RLG00000015022 RLG00000015023 RLG00000015024 RLG00000015027 RLG00000015028 RLG00000015030 RLG00000015031 RLG00000015034 RLG00000015035 RLG00000015038 RLG00000015041
rosa_multiflora Rmu_sc0001257.1_g000004 Rmu_sc0001257.1_g000008 Rmu_sc0001257.1_g000014 Rmu_sc0001257.1_g000016 Rmu_sc0001257.1_g000019 Rmu_sc0001257.1_g000026 Rmu_sc0002560.1_g000013 Rmu_sc0002560.1_g000020 Rmu_sc0002560.1_g000021 Rmu_sc0003855.1_g000005 Rmu_sc0003855.1_g000011 Rmu_sc0003898.1_g000003 Rmu_sc0003898.1_g000005 Rmu_sc0003898.1_g000016 Rmu_sc0003898.1_g000017 Rmu_sc0005439.1_g000007 Rmu_sc0005439.1_g000014 Rmu_sc0005439.1_g000021
rosa_roxburghii Rroxscaffold_7G00211930 Rroxscaffold_7G00211940 Rroxscaffold_7G00211960 Rroxscaffold_7G00211980 Rroxscaffold_7G00211990 Rroxscaffold_7G00212000 Rroxscaffold_7G00212050 Rroxscaffold_7G00212060 Rroxscaffold_7G00212070 Rroxscaffold_7G00212080 Rroxscaffold_7G00212160
rosa_rugosa Rorug05G0542900 Rorug05G0542900 Rorug05G0543000 Rorug05G0543100 Rorug05G0543100 Rorug05G0543200 Rorug05G0543300 Rorug05G0543400 Rorug05G0543400 Rorug05G0543500 Rorug05G0543600 Rorug05G0543700
rosa_samantha Rh6CG050000 Rh6DG045200 Rh6DG045500 Rh6DG045600 Rh6DG045700 Rh6DG045800 Rh6DG046200 Rh6DG046300 Rh6DG046400 Rh6DG046500 Rh6DG046700 Rh6DG046800
rosa_wichuraiana Rw0G000070 Rw6G005230 Rw6G005240 Rw6G005280 Rw6G005290

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 191
AcsI RAATTY 1 cut(s) 210
AflII CTTAAG 2 cut(s) 242, 430
AgsI TTSAA 4 cut(s) 46, 104, 121, 147
AluBI AGCT 5 cut(s) 107, 143, 386, 409, 429
AluI AGCT 5 cut(s) 107, 143, 386, 409, 429
Alw26I GTCTC 1 cut(s) 302
AoxI GGCC 1 cut(s) 126
ApeKI GCWGC 2 cut(s) 140, 386
ApoI RAATTY 1 cut(s) 210
BbsI GAAGAC 1 cut(s) 174
BbvI GCAGC 2 cut(s) 152, 373
BccI CCATC 2 cut(s) 43, 326
BcoDI GTCTC 1 cut(s) 302
BfaI CTAG 4 cut(s) 108, 137, 254, 363
BfrI CTTAAG 2 cut(s) 242, 430
BisI GCNGC 2 cut(s) 141, 387
BlsI GCNGC 2 cut(s) 142, 388
BmsI GCATC 1 cut(s) 187
BpiI GAAGAC 1 cut(s) 174
Bse1I ACTGG 1 cut(s) 394
BseGI GGATG 1 cut(s) 10
BseMII CTCAG 3 cut(s) 144, 234, 419
BseNI ACTGG 1 cut(s) 394
BseRI GAGGAG 1 cut(s) 239
BseXI GCAGC 2 cut(s) 152, 373
Bsh1285I CGRYCG 1 cut(s) 306
BshFI GGCC 1 cut(s) 128
BsiEI CGRYCG 1 cut(s) 306
BsmAI GTCTC 1 cut(s) 302
BsnI GGCC 1 cut(s) 128
Bsp143I GATC 1 cut(s) 303
BspANI GGCC 1 cut(s) 128
BspCNI CTCAG 3 cut(s) 143, 233, 418
BspTI CTTAAG 2 cut(s) 242, 430
BsrI ACTGG 1 cut(s) 394
BssMI GATC 1 cut(s) 303
BssNAI GTATAC 1 cut(s) 192
Bst1107I GTATAC 1 cut(s) 192
Bst6I CTCTTC 1 cut(s) 370
BstAFI CTTAAG 2 cut(s) 242, 430
BstDEI CTNAG 4 cut(s) 130, 220, 349, 405
BstF5I GGATG 1 cut(s) 10
BstKTI GATC 1 cut(s) 306
BstMAI GTCTC 1 cut(s) 302
BstMBI GATC 1 cut(s) 303
BstMCI CGRYCG 1 cut(s) 306
BstMWI GCNNNNNNNGC 1 cut(s) 254
BstV1I GCAGC 2 cut(s) 152, 373
BstV2I GAAGAC 1 cut(s) 174
BstZ17I GTATAC 1 cut(s) 192
BsuRI GGCC 1 cut(s) 128
BtsCI GGATG 1 cut(s) 10
CseI GACGC 1 cut(s) 29
CspCI CAANNNNNGTGG 2 cut(s) 401, 436
CviAII CATG 2 cut(s) 367, 456
CviJI RGCY 9 cut(s) 13, 50, 107, 128, 143, 248, 386, 409, 429
CviKI_1 RGCY 9 cut(s) 13, 50, 107, 128, 143, 248, 386, 409, 429
DdeI CTNAG 4 cut(s) 130, 220, 349, 405
DpnI GATC 1 cut(s) 305
DpnII GATC 1 cut(s) 303
Eam1104I CTCTTC 1 cut(s) 370
EarI CTCTTC 1 cut(s) 370
FaeI CATG 2 cut(s) 370, 459
FaiI YATR 3 cut(s) 192, 368, 457
FalI AAGNNNNNCTT 2 cut(s) 198, 230
FatI CATG 2 cut(s) 366, 455
FblI GTMKAC 1 cut(s) 191
Fnu4HI GCNGC 2 cut(s) 141, 387
FokI GGATG 1 cut(s) 17
Fsp4HI GCNGC 2 cut(s) 141, 387
FspBI CTAG 4 cut(s) 108, 137, 254, 363
GluI GCNGC 2 cut(s) 141, 387
HaeIII GGCC 1 cut(s) 128
HgaI GACGC 1 cut(s) 29
Hin1II CATG 2 cut(s) 370, 459
HinfI GANTC 4 cut(s) 179, 299, 310, 378
Hpy166II GTNNAC 1 cut(s) 192
Hpy188I TCNGA 4 cut(s) 40, 133, 223, 346
Hpy188III TCNNGA 1 cut(s) 307
Hpy8I GTNNAC 1 cut(s) 192
HpyAV CCTTC 3 cut(s) 40, 115, 268
HpyCH4V TGCA 2 cut(s) 200, 455
HpyF10VI GCNNNNNNNGC 1 cut(s) 254
HpyF3I CTNAG 4 cut(s) 130, 220, 349, 405
Hsp92II CATG 2 cut(s) 370, 459
Kzo9I GATC 1 cut(s) 303
LpnPI CCDG 2 cut(s) 43, 407
Lsp1109I GCAGC 2 cut(s) 152, 373
LweI GCATC 1 cut(s) 187
MaeI CTAG 4 cut(s) 108, 137, 254, 363
MalI GATC 1 cut(s) 305
MboI GATC 1 cut(s) 303
MboII GAAGA 3 cut(s) 68, 174, 387
MluCI AATT 5 cut(s) 25, 41, 147, 210, 231
MlyI GAGTC 3 cut(s) 188, 304, 387
MmeI TCCRAC 1 cut(s) 196
MnlI CCTC 8 cut(s) 62, 100, 139, 217, 229, 283, 331, 364
MseI TTAA 4 cut(s) 65, 243, 317, 431
MspCI CTTAAG 2 cut(s) 242, 430
MwoI GCNNNNNNNGC 1 cut(s) 254
NdeII GATC 1 cut(s) 303
NlaIII CATG 2 cut(s) 370, 459
PfeI GAWTC 1 cut(s) 299
PkrI GCNGC 2 cut(s) 142, 388
Ple19I CGATCG 1 cut(s) 306
PleI GAGTC 3 cut(s) 187, 304, 386
PpsI GAGTC 3 cut(s) 187, 304, 386
PvuI CGATCG 1 cut(s) 306
SaqAI TTAA 4 cut(s) 65, 243, 317, 431
SatI GCNGC 2 cut(s) 141, 387
Sau3AI GATC 1 cut(s) 303
SchI GAGTC 3 cut(s) 188, 304, 387
SfaNI GCATC 1 cut(s) 187
SmlI CTYRAG 2 cut(s) 242, 430
SmoI CTYRAG 2 cut(s) 242, 430
Sse9I AATT 5 cut(s) 25, 41, 147, 210, 231
SspMI CTAG 4 cut(s) 108, 137, 254, 363
TaqI TCGA 3 cut(s) 302, 306, 313
TasI AATT 5 cut(s) 25, 41, 147, 210, 231
TfiI GAWTC 1 cut(s) 299
Tru1I TTAA 4 cut(s) 65, 243, 317, 431
Tru9I TTAA 4 cut(s) 65, 243, 317, 431
TseI GCWGC 2 cut(s) 140, 386
TspDTI ATGAA 1 cut(s) 48
Vha464I CTTAAG 2 cut(s) 242, 430
XapI RAATTY 1 cut(s) 210
XmiI GTMKAC 1 cut(s) 191
XspI CTAG 4 cut(s) 108, 137, 254, 363
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.