RchiOBHm_Chr6g0262631

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Forward (+)
17474286 .. 17474936
651 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ23552

Sequence Viewer

Length: 159 bp
ATGTGTTCTGAGGACGGAGAGGTCCGAAGTTCGACGGTTAAGGATAACCGGAGTGGTTGTGTTCTGAGGACGGGAATGTCTGAAGTTCGACGGTTAAGGATAACCGAAGTGTATTGTTCTGAGGGCCGAGAGCCCAAAGTTCGAGGGTTATTAAGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

52

Amino Acids

5.83

Weight (kDa)

8.63

Isoelectric Point (pI)

69.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 2 cut(s) 20, 76
AcuI CTGAAG 1 cut(s) 102
AoxI GGCC 1 cut(s) 124
AspS9I GGNCC 2 cut(s) 22, 124
AvaII GGWCC 1 cut(s) 22
BanII GRGCYC 1 cut(s) 135
Bme18I GGWCC 1 cut(s) 22
BmgT120I GGNCC 2 cut(s) 22, 124
BsaWI WCCGGW 1 cut(s) 48
BsaXI ACNNNNNCTCC 2 cut(s) 43, 73
BseMII CTCAG 2 cut(s) 56, 111
BshFI GGCC 1 cut(s) 126
BsiSI CCGG 1 cut(s) 49
BsnI GGCC 1 cut(s) 126
Bsp1286I GDGCHC 1 cut(s) 135
BspANI GGCC 1 cut(s) 126
BspCNI CTCAG 2 cut(s) 57, 112
Bst4CI ACNGT 2 cut(s) 37, 93
BstDEI CTNAG 3 cut(s) 9, 65, 120
BsuRI GGCC 1 cut(s) 126
Cfr13I GGNCC 2 cut(s) 22, 124
CviJI RGCY 2 cut(s) 126, 133
CviKI_1 RGCY 2 cut(s) 126, 133
DdeI CTNAG 3 cut(s) 9, 65, 120
DrdI GACNNNNNNGTC 2 cut(s) 20, 76
DseDI GACNNNNNNGTC 2 cut(s) 20, 76
Eco24I GRGCYC 1 cut(s) 135
Eco47I GGWCC 1 cut(s) 22
Eco57I CTGAAG 1 cut(s) 102
EcoT38I GRGCYC 1 cut(s) 135
FriOI GRGCYC 1 cut(s) 135
HaeIII GGCC 1 cut(s) 126
HapII CCGG 1 cut(s) 49
HpaII CCGG 1 cut(s) 49
Hpy188I TCNGA 5 cut(s) 10, 26, 66, 82, 121
Hpy99I CGWCG 2 cut(s) 37, 93
HpyCH4III ACNGT 2 cut(s) 37, 93
HpyF3I CTNAG 3 cut(s) 9, 65, 120
LpnPI CCDG 1 cut(s) 62
MhlI GDGCHC 1 cut(s) 135
MnlI CCTC 5 cut(s) 4, 13, 60, 115, 137
MseI TTAA 4 cut(s) 39, 95, 152, 157
MspI CCGG 1 cut(s) 49
NmeAIII GCCGAG 1 cut(s) 152
PspPI GGNCC 2 cut(s) 22, 124
SaqAI TTAA 4 cut(s) 39, 95, 152, 157
Sau96I GGNCC 2 cut(s) 22, 124
SduI GDGCHC 1 cut(s) 135
SetI ASST 1 cut(s) 24
SgeI CNNG 4 cut(s) 61, 84, 140, 155
SinI GGWCC 1 cut(s) 22
TaaI ACNGT 2 cut(s) 37, 93
TaqI TCGA 3 cut(s) 32, 88, 142
Tru1I TTAA 4 cut(s) 39, 95, 152, 157
Tru9I TTAA 4 cut(s) 39, 95, 152, 157
TspGWI ACGGA 1 cut(s) 30
VpaK11BI GGWCC 1 cut(s) 22
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.