RchiOBHm_Chr7g0195651
BZIP Family

Common plant regulatory factor

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Reverse (-)
13450718 .. 13453859
3142 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ17499

Sequence Viewer

Length: 840 bp
ATGGACCAAGATGTAACAAAGAAGTTCAAGGGATTGGATGGGCATGCAGTACCAATTGCATATGTAAGTTCCAAGGGAAATTCTGGGCACCCAGTTCTTGAGGCATCCAAGAGTTTCGAAGAAAATAAGGATGGTTTGACAGGCGGAGCTGATGGAAACACTCGAGCAGACCACCACAGGCAAGGGAAAAATGGGTCTTACAGCGTGCCAACTTCTGATAATGATGTGAAAGACCATCCCCAGGTCCATCCAAACAATGAAGGGGAAATAAATAGGAACTTCGCAACCTCTAATGATCTTGTGCGAGTACCTATTCCTTCTCCCTATGAGAAAATCGCAACTAGCACACCTTTCTTCTCTCCTTCTGCTGGTGAAAGGTTGCCTTTTGATGCAATGGTTCTGGATGAAAAGCAATTGAAACGAGAGAAAAGAAAACAGGCTAACAGAGAATCTGCAAGGAGATCTAGGATGAGGAAGCAAGCTGAATACGAGGAGCTGGTGAAAAGTTGTGATTCTTTAAGCACAGAACAGATGGACCTTAAATCTGAACTAGATCAATTGAAAGTGGATGCAGAAAAAATGAGGCTTGAAAATGCTGCATTAAGGGCGCAGCTGAAAAATGCTCAGGTAATGCAGGAAGGAGGGAACGCTTCCCCTAAGACTGAAGGTGACTTCACCCTGCCAAATGATGCTAAGAACATACTTAGCAATTTGGGTTCTGTAAGCAGTAATGCTCCGCCGGATTGTCAGACACATGAAACTTCTGTTTCTGAAACAGTTACCCGGCTCCGTCAGTTGTTGGAATCAAGCTCTAGGACTGATGCTGTTGCTGCTAGATGA

Protein Analysis

279

Amino Acids

30.69

Weight (kDa)

6.2

Isoelectric Point (pI)

45.12

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
bZIP_1 PF00170 136 - 198 4e-16 bZIP transcription factor
bZIP_2 PF07716 140 - 188 4.4e-07 Basic region leucine zipper
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 87
AciI CCGC 2 cut(s) 144, 737
AcsI RAATTY 1 cut(s) 79
AcuI CTGAAG 1 cut(s) 684
AfaI GTAC 2 cut(s) 51, 309
AfiI CCNNNNNNNGG 2 cut(s) 241, 368
AgsI TTSAA 4 cut(s) 28, 418, 562, 590
AjnI CCWGG 1 cut(s) 240
AluBI AGCT 5 cut(s) 149, 482, 496, 613, 810
AluI AGCT 5 cut(s) 149, 482, 496, 613, 810
Ama87I CYCGRG 1 cut(s) 162
ApeKI GCWGC 3 cut(s) 596, 610, 830
ApoI RAATTY 1 cut(s) 79
AspLEI GCGC 1 cut(s) 610
AspS9I GGNCC 3 cut(s) 4, 244, 535
AsuC2I CCSGG 1 cut(s) 784
AsuHPI GGTGA 4 cut(s) 383, 511, 667, 680
AsuII TTCGAA 1 cut(s) 117
AvaI CYCGRG 1 cut(s) 162
AvaII GGWCC 3 cut(s) 4, 244, 535
BaeGI GKGCMC 1 cut(s) 90
BanI GGYRCC 1 cut(s) 87
BbvI GCAGC 3 cut(s) 583, 622, 817
BccI CCATC 6 cut(s) 32, 125, 146, 243, 255, 526
BciT130I CCWGG 1 cut(s) 242
BcnI CCSGG 1 cut(s) 784
BfaI CTAG 5 cut(s) 342, 465, 551, 813, 834
BglII AGATCT 1 cut(s) 461
BisI GCNGC 3 cut(s) 597, 611, 831
BlsI GCNGC 3 cut(s) 598, 612, 832
Bme1390I CCNGG 2 cut(s) 242, 784
Bme18I GGWCC 3 cut(s) 4, 244, 535
BmeT110I CYCGRG 1 cut(s) 162
BmgT120I GGNCC 3 cut(s) 4, 244, 535
BmiI GGNNCC 2 cut(s) 89, 788
BmrFI CCNGG 2 cut(s) 242, 784
BmrI ACTGGG 1 cut(s) 86
BmsI GCATC 5 cut(s) 113, 379, 559, 679, 811
BmuI ACTGGG 1 cut(s) 86
Bpu10I CCTNAGC 1 cut(s) 624
Bpu14I TTCGAA 1 cut(s) 117
BpuEI CTTGAG 1 cut(s) 119
BpuMI CCSGG 1 cut(s) 784
BsaJI CCNNGG 2 cut(s) 72, 240
Bsc4I CCNNNNNNNGG 2 cut(s) 241, 368
Bse1I ACTGG 1 cut(s) 92
Bse3DI GCAATG 1 cut(s) 399
BseBI CCWGG 1 cut(s) 242
BseDI CCNNGG 2 cut(s) 72, 240
BseGI GGATG 8 cut(s) 43, 104, 136, 235, 247, 409, 474, 574
BseLI CCNNNNNNNGG 2 cut(s) 241, 368
BseMI GCAATG 1 cut(s) 399
BseMII CTCAG 1 cut(s) 638
BseNI ACTGG 1 cut(s) 92
BseRI GAGGAG 1 cut(s) 506
BseSI GKGCMC 1 cut(s) 90
BseXI GCAGC 3 cut(s) 583, 622, 817
BshNI GGYRCC 1 cut(s) 87
BsiHKCI CYCGRG 1 cut(s) 162
BsiSI CCGG 2 cut(s) 740, 784
BslI CCNNNNNNNGG 2 cut(s) 241, 368
BsoBI CYCGRG 1 cut(s) 162
Bsp119I TTCGAA 1 cut(s) 117
Bsp1286I GDGCHC 1 cut(s) 90
Bsp143I GATC 3 cut(s) 295, 461, 553
BspACI CCGC 2 cut(s) 144, 737
BspCNI CTCAG 1 cut(s) 637
BspLI GGNNCC 2 cut(s) 89, 788
BspT104I TTCGAA 1 cut(s) 117
BspT107I GGYRCC 1 cut(s) 87
BsrDI GCAATG 1 cut(s) 399
BsrI ACTGG 1 cut(s) 92
BssECI CCNNGG 2 cut(s) 72, 240
BssMI GATC 3 cut(s) 295, 461, 553
BssT1I CCWWGG 1 cut(s) 72
Bst2UI CCWGG 1 cut(s) 242
Bst4CI ACNGT 1 cut(s) 778
BstBI TTCGAA 1 cut(s) 117
BstC8I GCNNGC 3 cut(s) 45, 206, 480
BstDEI CTNAG 4 cut(s) 624, 657, 693, 704
BstF5I GGATG 8 cut(s) 43, 104, 136, 235, 247, 409, 474, 574
BstHHI GCGC 1 cut(s) 610
BstKTI GATC 3 cut(s) 298, 464, 556
BstMBI GATC 3 cut(s) 295, 461, 553
BstMWI GCNNNNNNNGC 2 cut(s) 605, 830
BstNI CCWGG 1 cut(s) 242
BstNSI RCATGY 1 cut(s) 47
BstSCI CCNGG 2 cut(s) 240, 782
BstSLI GKGCMC 1 cut(s) 90
BstV1I GCAGC 3 cut(s) 583, 622, 817
BstX2I RGATCY 1 cut(s) 461
BstYI RGATCY 1 cut(s) 461
BtsCI GGATG 8 cut(s) 43, 104, 136, 235, 247, 409, 474, 574
Cac8I GCNNGC 3 cut(s) 45, 206, 480
CfoI GCGC 1 cut(s) 610
Cfr13I GGNCC 3 cut(s) 4, 244, 535
Csp6I GTAC 2 cut(s) 50, 308
CviAII CATG 2 cut(s) 44, 755
CviJI RGCY 8 cut(s) 149, 440, 482, 496, 586, 613, 787, 810
CviKI_1 RGCY 8 cut(s) 149, 440, 482, 496, 586, 613, 787, 810
CviQI GTAC 2 cut(s) 50, 308
DdeI CTNAG 4 cut(s) 624, 657, 693, 704
DpnI GATC 3 cut(s) 297, 463, 555
DpnII GATC 3 cut(s) 295, 461, 553
EciI GGCGGA 2 cut(s) 159, 726
Eco130I CCWWGG 1 cut(s) 72
Eco47I GGWCC 3 cut(s) 4, 244, 535
Eco57I CTGAAG 1 cut(s) 684
Eco88I CYCGRG 1 cut(s) 162
EcoRII CCWGG 1 cut(s) 240
EcoT14I CCWWGG 1 cut(s) 72
ErhI CCWWGG 1 cut(s) 72
FaeI CATG 2 cut(s) 47, 758
FaiI YATR 6 cut(s) 45, 61, 63, 327, 701, 756
FalI AAGNNNNNCTT 2 cut(s) 367, 399
FatI CATG 2 cut(s) 43, 754
FauNDI CATATG 1 cut(s) 61
Fnu4HI GCNGC 3 cut(s) 597, 611, 831
FokI GGATG 8 cut(s) 50, 91, 143, 222, 234, 416, 481, 581
Fsp4HI GCNGC 3 cut(s) 597, 611, 831
FspBI CTAG 5 cut(s) 342, 465, 551, 813, 834
GlaI GCGC 1 cut(s) 609
GluI GCNGC 3 cut(s) 597, 611, 831
HapII CCGG 2 cut(s) 740, 784
HhaI GCGC 1 cut(s) 610
Hin1II CATG 2 cut(s) 47, 758
Hin6I GCGC 1 cut(s) 608
HinP1I GCGC 1 cut(s) 608
HinfI GANTC 3 cut(s) 449, 512, 803
HpaII CCGG 2 cut(s) 740, 784
HphI GGTGA 4 cut(s) 383, 511, 667, 680
Hpy188I TCNGA 4 cut(s) 217, 547, 750, 772
Hpy188III TCNNGA 2 cut(s) 98, 401
HpyAV CCTTC 5 cut(s) 254, 327, 372, 632, 659
HpyCH4III ACNGT 1 cut(s) 778
HpyCH4V TGCA 7 cut(s) 47, 59, 392, 455, 572, 599, 634
HpyF10VI GCNNNNNNNGC 2 cut(s) 605, 830
HpyF3I CTNAG 4 cut(s) 624, 657, 693, 704
Hsp92II CATG 2 cut(s) 47, 758
HspAI GCGC 1 cut(s) 608
Kzo9I GATC 3 cut(s) 295, 461, 553
LmnI GCTCC 4 cut(s) 146, 493, 739, 792
Lsp1109I GCAGC 3 cut(s) 583, 622, 817
LweI GCATC 5 cut(s) 113, 379, 559, 679, 811
MaeI CTAG 5 cut(s) 342, 465, 551, 813, 834
MaeIII GTNAC 3 cut(s) 13, 668, 778
MalI GATC 3 cut(s) 297, 463, 555
MboI GATC 3 cut(s) 295, 461, 553
MboII GAAGA 2 cut(s) 131, 346
MfeI CAATTG 3 cut(s) 54, 413, 557
MflI RGATCY 1 cut(s) 461
MhlI GDGCHC 1 cut(s) 90
MluCI AATT 5 cut(s) 54, 79, 413, 557, 709
MmeI TCCRAC 1 cut(s) 780
MnlI CCTC 6 cut(s) 94, 298, 465, 484, 576, 635
MseI TTAA 3 cut(s) 518, 540, 602
MspA1I CMGCKG 1 cut(s) 613
MspI CCGG 2 cut(s) 740, 784
MspR9I CCNGG 2 cut(s) 242, 784
MunI CAATTG 3 cut(s) 54, 413, 557
MvaI CCWGG 1 cut(s) 242
MwoI GCNNNNNNNGC 2 cut(s) 605, 830
NciI CCSGG 1 cut(s) 784
NdeI CATATG 1 cut(s) 61
NdeII GATC 3 cut(s) 295, 461, 553
NlaIII CATG 2 cut(s) 47, 758
NlaIV GGNNCC 2 cut(s) 89, 788
NmuCI GTSAC 1 cut(s) 668
NspI RCATGY 1 cut(s) 47
NspV TTCGAA 1 cut(s) 117
PaeI GCATGC 1 cut(s) 47
PaeR7I CTCGAG 1 cut(s) 162
PfeI GAWTC 3 cut(s) 449, 512, 803
PkrI GCNGC 3 cut(s) 598, 612, 832
Psp6I CCWGG 1 cut(s) 240
PspGI CCWGG 1 cut(s) 240
PspN4I GGNNCC 2 cut(s) 89, 788
PspPI GGNCC 3 cut(s) 4, 244, 535
PspXI VCTCGAGB 1 cut(s) 162
PsuI RGATCY 1 cut(s) 461
PvuII CAGCTG 1 cut(s) 613
RsaI GTAC 2 cut(s) 51, 309
RsaNI GTAC 2 cut(s) 50, 308
SaqAI TTAA 3 cut(s) 518, 540, 602
SatI GCNGC 3 cut(s) 597, 611, 831
Sau3AI GATC 3 cut(s) 295, 461, 553
Sau96I GGNCC 3 cut(s) 4, 244, 535
ScrFI CCNGG 2 cut(s) 242, 784
SduI GDGCHC 1 cut(s) 90
SfaNI GCATC 5 cut(s) 113, 379, 559, 679, 811
Sfr274I CTCGAG 1 cut(s) 162
SfuI TTCGAA 1 cut(s) 117
SinI GGWCC 3 cut(s) 4, 244, 535
SlaI CTCGAG 1 cut(s) 162
SmlI CTYRAG 2 cut(s) 98, 162
SmoI CTYRAG 2 cut(s) 98, 162
SphI GCATGC 1 cut(s) 47
Sse9I AATT 5 cut(s) 54, 79, 413, 557, 709
SsiI CCGC 2 cut(s) 144, 737
SspMI CTAG 5 cut(s) 342, 465, 551, 813, 834
StyD4I CCNGG 2 cut(s) 240, 782
StyI CCWWGG 1 cut(s) 72
TaaI ACNGT 1 cut(s) 778
TaqI TCGA 2 cut(s) 117, 163
TasI AATT 5 cut(s) 54, 79, 413, 557, 709
TfiI GAWTC 3 cut(s) 449, 512, 803
Tru1I TTAA 3 cut(s) 518, 540, 602
Tru9I TTAA 3 cut(s) 518, 540, 602
TseFI GTSAC 1 cut(s) 668
TseI GCWGC 3 cut(s) 596, 610, 830
Tsp45I GTSAC 1 cut(s) 668
TspDTI ATGAA 3 cut(s) 273, 420, 771
TspGWI ACGGA 1 cut(s) 779
VpaK11BI GGWCC 3 cut(s) 4, 244, 535
XapI RAATTY 1 cut(s) 79
XceI RCATGY 1 cut(s) 47
XhoI CTCGAG 1 cut(s) 162
XspI CTAG 5 cut(s) 342, 465, 551, 813, 834
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.