RchiOBHm_Chr7g0226991

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
OG0016451
Physical Location & Seq
Forward (+)
50352393 .. 50359352
6960 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ20327

Sequence Viewer

Length: 345 bp
ATGCAAACTTGGCAAGGTTATACACACGCAGGTGTGGTTTCCTTATCAGTTTGGTTTTGTCGTGAAACAATCTTTGAAGCCTTGCAAAGGTGGAATGGAAGAGCTCCCTCTGATGGCCTACTCCTGGGCTTCTGTATTGTCTTGATGGGCTTGGCTTGTGTCCCTATTGTGGCTCTCCACTTCTCTCATGTCTTGGTATCAAGAGAAGGACCTGGTTGGACGATTCATGAATGTATTTATGAATGTCAAGATATCAAGTGGGAGAGGAGAGGCAACAACCAATACACCCAAGCGGATCAAGTGCGAAATGAGTGGGGGAAGTTTGTTGTCAACACATGTGCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

114

Amino Acids

13.05

Weight (kDa)

6.39

Isoelectric Point (pI)

26.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 20
Acc36I ACCTGC 1 cut(s) 20
AciI CCGC 1 cut(s) 293
AclWI GGATC 1 cut(s) 303
AfiI CCNNNNNNNGG 4 cut(s) 87, 113, 124, 169
AflIII ACRYGT 1 cut(s) 335
AgsI TTSAA 1 cut(s) 77
AjnI CCWGG 2 cut(s) 123, 211
AleI CACNNNNGTG 1 cut(s) 30
AluBI AGCT 1 cut(s) 104
AluI AGCT 1 cut(s) 104
Alw21I GWGCWC 1 cut(s) 106
AlwI GGATC 1 cut(s) 303
AoxI GGCC 1 cut(s) 115
AspS9I GGNCC 1 cut(s) 209
AvaII GGWCC 1 cut(s) 209
BanII GRGCYC 1 cut(s) 106
Bbv12I GWGCWC 1 cut(s) 106
BccI CCATC 2 cut(s) 107, 139
BciT130I CCWGG 2 cut(s) 125, 213
BfuAI ACCTGC 1 cut(s) 20
Bme1390I CCNGG 2 cut(s) 125, 213
Bme18I GGWCC 1 cut(s) 209
BmgT120I GGNCC 1 cut(s) 209
BmrFI CCNGG 2 cut(s) 125, 213
BsaJI CCNNGG 1 cut(s) 124
Bsc4I CCNNNNNNNGG 4 cut(s) 87, 113, 124, 169
BseBI CCWGG 2 cut(s) 125, 213
BseDI CCNNGG 1 cut(s) 124
BseLI CCNNNNNNNGG 4 cut(s) 87, 113, 124, 169
BseRI GAGGAG 1 cut(s) 280
BshFI GGCC 1 cut(s) 117
BsiHKAI GWGCWC 1 cut(s) 106
BslFI GGGAC 1 cut(s) 146
BslI CCNNNNNNNGG 4 cut(s) 87, 113, 124, 169
BsmFI GGGAC 1 cut(s) 146
BsnI GGCC 1 cut(s) 117
Bsp1286I GDGCHC 1 cut(s) 106
Bsp143I GATC 1 cut(s) 295
BspACI CCGC 1 cut(s) 293
BspANI GGCC 1 cut(s) 117
BspHI TCATGA 1 cut(s) 226
BspMI ACCTGC 1 cut(s) 20
BspPI GGATC 1 cut(s) 303
BspQI GCTCTTC 1 cut(s) 94
BssECI CCNNGG 1 cut(s) 124
BssMI GATC 1 cut(s) 295
Bst2UI CCWGG 2 cut(s) 125, 213
Bst6I CTCTTC 1 cut(s) 94
BstENI CCTNNNNNAGG 1 cut(s) 85
BstKTI GATC 1 cut(s) 298
BstMBI GATC 1 cut(s) 295
BstMWI GCNNNNNNNGC 1 cut(s) 10
BstNI CCWGG 2 cut(s) 125, 213
BstNSI RCATGY 1 cut(s) 339
BstSCI CCNGG 2 cut(s) 123, 211
BsuRI GGCC 1 cut(s) 117
BveI ACCTGC 1 cut(s) 20
CciI TCATGA 1 cut(s) 226
Cfr13I GGNCC 1 cut(s) 209
CsiI ACCWGGT 1 cut(s) 211
CviAII CATG 3 cut(s) 188, 227, 336
CviJI RGCY 7 cut(s) 80, 104, 117, 129, 150, 155, 173
CviKI_1 RGCY 7 cut(s) 80, 104, 117, 129, 150, 155, 173
DpnI GATC 1 cut(s) 297
DpnII GATC 1 cut(s) 295
Eam1104I CTCTTC 1 cut(s) 94
EarI CTCTTC 1 cut(s) 94
Ecl136II GAGCTC 1 cut(s) 104
Eco24I GRGCYC 1 cut(s) 106
Eco32I GATATC 1 cut(s) 253
Eco47I GGWCC 1 cut(s) 209
Eco53kI GAGCTC 1 cut(s) 104
EcoICRI GAGCTC 1 cut(s) 104
EcoNI CCTNNNNNAGG 1 cut(s) 85
EcoO109I RGGNCCY 1 cut(s) 209
EcoRII CCWGG 2 cut(s) 123, 211
EcoRV GATATC 1 cut(s) 253
EcoT38I GRGCYC 1 cut(s) 106
FaeI CATG 3 cut(s) 191, 230, 339
FaiI YATR 6 cut(s) 21, 189, 228, 240, 337, 343
FaqI GGGAC 1 cut(s) 146
FatI CATG 3 cut(s) 187, 226, 335
FriOI GRGCYC 1 cut(s) 106
HaeIII GGCC 1 cut(s) 117
Hin1II CATG 3 cut(s) 191, 230, 339
HincII GTYRAC 1 cut(s) 331
HindII GTYRAC 1 cut(s) 331
HinfI GANTC 1 cut(s) 223
Hpy166II GTNNAC 1 cut(s) 331
Hpy188I TCNGA 1 cut(s) 112
Hpy188III TCNNGA 5 cut(s) 62, 142, 201, 227, 248
Hpy8I GTNNAC 1 cut(s) 331
HpyAV CCTTC 1 cut(s) 200
HpyCH4V TGCA 3 cut(s) 4, 85, 341
HpyF10VI GCNNNNNNNGC 1 cut(s) 10
Hsp92II CATG 3 cut(s) 191, 230, 339
Kzo9I GATC 1 cut(s) 295
LguI GCTCTTC 1 cut(s) 94
LmnI GCTCC 1 cut(s) 109
LpnPI CCDG 5 cut(s) 15, 110, 137, 198, 225
MabI ACCWGGT 1 cut(s) 211
MalI GATC 1 cut(s) 297
MboI GATC 1 cut(s) 295
MboII GAAGA 1 cut(s) 111
MhlI GDGCHC 1 cut(s) 106
MmeI TCCRAC 1 cut(s) 197
MnlI CCTC 3 cut(s) 118, 258, 263
MslI CAYNNNNRTG 1 cut(s) 30
MspR9I CCNGG 2 cut(s) 125, 213
MvaI CCWGG 2 cut(s) 125, 213
MwoI GCNNNNNNNGC 1 cut(s) 10
NdeII GATC 1 cut(s) 295
NlaIII CATG 3 cut(s) 191, 230, 339
NspI RCATGY 1 cut(s) 339
OliI CACNNNNGTG 1 cut(s) 30
PagI TCATGA 1 cut(s) 226
PaqCI CACCTGC 1 cut(s) 20
PciI ACATGT 1 cut(s) 335
PciSI GCTCTTC 1 cut(s) 94
PfeI GAWTC 1 cut(s) 223
PpuMI RGGWCCY 1 cut(s) 209
PscI ACATGT 1 cut(s) 335
Psp124BI GAGCTC 1 cut(s) 106
Psp5II RGGWCCY 1 cut(s) 209
Psp6I CCWGG 2 cut(s) 123, 211
PspGI CCWGG 2 cut(s) 123, 211
PspPI GGNCC 1 cut(s) 209
PspPPI RGGWCCY 1 cut(s) 209
RseI CAYNNNNRTG 1 cut(s) 30
SacI GAGCTC 1 cut(s) 106
SapI GCTCTTC 1 cut(s) 94
Sau3AI GATC 1 cut(s) 295
Sau96I GGNCC 1 cut(s) 209
ScrFI CCNGG 2 cut(s) 125, 213
SduI GDGCHC 1 cut(s) 106
SetI ASST 5 cut(s) 19, 34, 92, 106, 214
SexAI ACCWGGT 1 cut(s) 211
SinI GGWCC 1 cut(s) 209
SmiMI CAYNNNNRTG 1 cut(s) 30
SsiI CCGC 1 cut(s) 293
SstI GAGCTC 1 cut(s) 106
StyD4I CCNGG 2 cut(s) 123, 211
TfiI GAWTC 1 cut(s) 223
TspDTI ATGAA 3 cut(s) 215, 243, 255
VpaK11BI GGWCC 1 cut(s) 209
XagI CCTNNNNNAGG 1 cut(s) 85
XceI RCATGY 1 cut(s) 339
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.