Rh1BG300600

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
Physical Location & Seq
Reverse (-)
43570891 .. 43574759
3869 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG300600.1

Sequence Viewer

Length: 180 bp
ATGTTGGTTTTCTTTGGGCTTTTGCTTCAGATATACAAAGAGAATAGAAAAGCAATTGAAGATGTTGCCAAGAGAAATGACATGGGTTTTGCTAGCGAACTGATAGTATATGATTATCAAGGCCCAGACACTTCCATTGGAGGTCCAAAGTCATGGCCTTGGAGAAGAAGCAAGATGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

59

Amino Acids

6.87

Weight (kDa)

9.16

Isoelectric Point (pI)

58.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 11
AgsI TTSAA 1 cut(s) 59
AoxI GGCC 2 cut(s) 121, 155
ArsI GACNNNNNNTTYG 2 cut(s) 71, 103
AspS9I GGNCC 2 cut(s) 122, 143
AsuNHI GCTAGC 1 cut(s) 92
AvaII GGWCC 1 cut(s) 143
BfaI CTAG 1 cut(s) 93
Bme18I GGWCC 1 cut(s) 143
BmgT120I GGNCC 2 cut(s) 122, 143
BmtI GCTAGC 1 cut(s) 96
BsaJI CCNNGG 1 cut(s) 158
BseDI CCNNGG 1 cut(s) 158
BshFI GGCC 2 cut(s) 123, 157
BsnI GGCC 2 cut(s) 123, 157
BspANI GGCC 2 cut(s) 123, 157
BspOI GCTAGC 1 cut(s) 96
BssECI CCNNGG 1 cut(s) 158
BssT1I CCWWGG 1 cut(s) 158
BstC8I GCNNGC 1 cut(s) 94
BstXI CCANNNNNNTGG 1 cut(s) 153
BsuRI GGCC 2 cut(s) 123, 157
Cac8I GCNNGC 1 cut(s) 94
Cfr13I GGNCC 2 cut(s) 122, 143
CviAII CATG 2 cut(s) 82, 153
CviJI RGCY 3 cut(s) 19, 123, 157
CviKI_1 RGCY 3 cut(s) 19, 123, 157
Eco130I CCWWGG 1 cut(s) 158
Eco47I GGWCC 1 cut(s) 143
Eco57I CTGAAG 1 cut(s) 11
EcoT14I CCWWGG 1 cut(s) 158
ErhI CCWWGG 1 cut(s) 158
FaeI CATG 2 cut(s) 85, 156
FaiI YATR 5 cut(s) 34, 83, 109, 111, 154
FatI CATG 2 cut(s) 81, 152
FspBI CTAG 1 cut(s) 93
HaeIII GGCC 2 cut(s) 123, 157
Hin1II CATG 2 cut(s) 85, 156
Hpy188I TCNGA 1 cut(s) 30
Hsp92II CATG 2 cut(s) 85, 156
LpnPI CCDG 1 cut(s) 138
MaeI CTAG 1 cut(s) 93
MboII GAAGA 2 cut(s) 71, 177
MfeI CAATTG 1 cut(s) 54
MluCI AATT 1 cut(s) 54
MnlI CCTC 1 cut(s) 134
MunI CAATTG 1 cut(s) 54
NheI GCTAGC 1 cut(s) 92
NlaIII CATG 2 cut(s) 85, 156
PspPI GGNCC 2 cut(s) 122, 143
Sau96I GGNCC 2 cut(s) 122, 143
SetI ASST 1 cut(s) 145
SgeI CNNG 7 cut(s) 82, 94, 105, 131, 137, 165, 171
SinI GGWCC 1 cut(s) 143
Sse9I AATT 1 cut(s) 54
SspMI CTAG 1 cut(s) 93
StyI CCWWGG 1 cut(s) 158
TasI AATT 1 cut(s) 54
VpaK11BI GGWCC 1 cut(s) 143
XspI CTAG 1 cut(s) 93
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.