Rh5CG407100

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Reverse (-)
54657265 .. 54661012
3748 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG407100.1

Sequence Viewer

Length: 351 bp
ATGAATTGCGAACTGATAGTATATGATTATCAAGGCCCAGACACTTCCATTGGAGGTCCAAAGTCATGGAACTTCCGTACAATCCAAGGAGTTGTCTTGGATAAGTCAAGGACAGCCTCAAAGATGCAAACTTGGCAAGGTTATACACACGCAGGTGTGGTTTCCTTATCAGTTTGGTTTTGTCGTGAAACAATCTTTGAAGCCTTGCAAAGGTGGAATGGAAGAGCTCCCTCTGATGGCCTACTCCTGGGCTTCTGTATTGTCTTGATGGGCTTGGCTTGTGTCCCTATTGTGGCTCTCCACTTCTCTCATGTCTTGATCAAGAGAAGGACCTGGTTGGACGATTCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

116

Amino Acids

13.08

Weight (kDa)

8.44

Isoelectric Point (pI)

31.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 143
Acc36I ACCTGC 1 cut(s) 143
AfaI GTAC 1 cut(s) 79
AfiI CCNNNNNNNGG 4 cut(s) 210, 236, 247, 292
AgsI TTSAA 1 cut(s) 200
AjnI CCWGG 2 cut(s) 246, 332
AleI CACNNNNGTG 1 cut(s) 153
AluBI AGCT 1 cut(s) 227
AluI AGCT 1 cut(s) 227
Alw21I GWGCWC 1 cut(s) 229
AoxI GGCC 2 cut(s) 34, 238
AspS9I GGNCC 3 cut(s) 35, 56, 330
AvaII GGWCC 2 cut(s) 56, 330
BanII GRGCYC 1 cut(s) 229
Bbv12I GWGCWC 1 cut(s) 229
BccI CCATC 2 cut(s) 230, 262
BciT130I CCWGG 2 cut(s) 248, 334
BclI TGATCA 1 cut(s) 318
BfuAI ACCTGC 1 cut(s) 143
Bme1390I CCNGG 2 cut(s) 248, 334
Bme18I GGWCC 2 cut(s) 56, 330
BmgT120I GGNCC 3 cut(s) 35, 56, 330
BmrFI CCNGG 2 cut(s) 248, 334
BmsI GCATC 1 cut(s) 114
BsaJI CCNNGG 2 cut(s) 85, 247
Bsc4I CCNNNNNNNGG 4 cut(s) 210, 236, 247, 292
BseBI CCWGG 2 cut(s) 248, 334
BseDI CCNNGG 2 cut(s) 85, 247
BseLI CCNNNNNNNGG 4 cut(s) 210, 236, 247, 292
BshFI GGCC 2 cut(s) 36, 240
BsiHKAI GWGCWC 1 cut(s) 229
BslFI GGGAC 1 cut(s) 269
BslI CCNNNNNNNGG 4 cut(s) 210, 236, 247, 292
BsmFI GGGAC 1 cut(s) 269
BsnI GGCC 2 cut(s) 36, 240
Bsp1286I GDGCHC 1 cut(s) 229
Bsp143I GATC 1 cut(s) 318
BspANI GGCC 2 cut(s) 36, 240
BspHI TCATGA 1 cut(s) 347
BspMI ACCTGC 1 cut(s) 143
BspQI GCTCTTC 1 cut(s) 217
BssECI CCNNGG 2 cut(s) 85, 247
BssMI GATC 1 cut(s) 318
BssT1I CCWWGG 1 cut(s) 85
Bst2UI CCWGG 2 cut(s) 248, 334
Bst6I CTCTTC 1 cut(s) 217
BstENI CCTNNNNNAGG 1 cut(s) 208
BstKTI GATC 1 cut(s) 321
BstMBI GATC 1 cut(s) 318
BstMWI GCNNNNNNNGC 1 cut(s) 133
BstNI CCWGG 2 cut(s) 248, 334
BstSCI CCNGG 2 cut(s) 246, 332
BstXI CCANNNNNNTGG 1 cut(s) 66
BsuRI GGCC 2 cut(s) 36, 240
BveI ACCTGC 1 cut(s) 143
CciI TCATGA 1 cut(s) 347
Cfr13I GGNCC 3 cut(s) 35, 56, 330
CsiI ACCWGGT 1 cut(s) 332
Csp6I GTAC 1 cut(s) 78
CviAII CATG 3 cut(s) 66, 311, 348
CviJI RGCY 9 cut(s) 36, 116, 203, 227, 240, 252, 273, 278, 296
CviKI_1 RGCY 9 cut(s) 36, 116, 203, 227, 240, 252, 273, 278, 296
CviQI GTAC 1 cut(s) 78
DpnI GATC 1 cut(s) 320
DpnII GATC 1 cut(s) 318
Eam1104I CTCTTC 1 cut(s) 217
EarI CTCTTC 1 cut(s) 217
Ecl136II GAGCTC 1 cut(s) 227
Eco130I CCWWGG 1 cut(s) 85
Eco24I GRGCYC 1 cut(s) 229
Eco47I GGWCC 2 cut(s) 56, 330
Eco53kI GAGCTC 1 cut(s) 227
EcoICRI GAGCTC 1 cut(s) 227
EcoNI CCTNNNNNAGG 1 cut(s) 208
EcoO109I RGGNCCY 1 cut(s) 330
EcoRII CCWGG 2 cut(s) 246, 332
EcoT14I CCWWGG 1 cut(s) 85
EcoT38I GRGCYC 1 cut(s) 229
ErhI CCWWGG 1 cut(s) 85
FaeI CATG 3 cut(s) 69, 314, 351
FaiI YATR 6 cut(s) 22, 24, 67, 144, 312, 349
FaqI GGGAC 1 cut(s) 269
FatI CATG 3 cut(s) 65, 310, 347
FbaI TGATCA 1 cut(s) 318
FriOI GRGCYC 1 cut(s) 229
HaeIII GGCC 2 cut(s) 36, 240
Hin1II CATG 3 cut(s) 69, 314, 351
HinfI GANTC 1 cut(s) 344
Hpy188I TCNGA 1 cut(s) 235
Hpy188III TCNNGA 5 cut(s) 185, 265, 316, 322, 348
HpyAV CCTTC 1 cut(s) 321
HpyCH4V TGCA 2 cut(s) 127, 208
HpyF10VI GCNNNNNNNGC 1 cut(s) 133
Hsp92II CATG 3 cut(s) 69, 314, 351
Ksp22I TGATCA 1 cut(s) 318
Kzo9I GATC 1 cut(s) 318
LguI GCTCTTC 1 cut(s) 217
LmnI GCTCC 1 cut(s) 232
LpnPI CCDG 6 cut(s) 51, 138, 233, 260, 319, 346
LweI GCATC 1 cut(s) 114
MabI ACCWGGT 1 cut(s) 332
MalI GATC 1 cut(s) 320
MboI GATC 1 cut(s) 318
MboII GAAGA 1 cut(s) 234
MhlI GDGCHC 1 cut(s) 229
MluCI AATT 1 cut(s) 4
MmeI TCCRAC 1 cut(s) 318
MnlI CCTC 3 cut(s) 47, 127, 241
MslI CAYNNNNRTG 1 cut(s) 153
MspR9I CCNGG 2 cut(s) 248, 334
MvaI CCWGG 2 cut(s) 248, 334
MwoI GCNNNNNNNGC 1 cut(s) 133
NdeII GATC 1 cut(s) 318
NlaIII CATG 3 cut(s) 69, 314, 351
OliI CACNNNNGTG 1 cut(s) 153
PagI TCATGA 1 cut(s) 347
PaqCI CACCTGC 1 cut(s) 143
PciSI GCTCTTC 1 cut(s) 217
PfeI GAWTC 1 cut(s) 344
PpuMI RGGWCCY 1 cut(s) 330
Psp124BI GAGCTC 1 cut(s) 229
Psp5II RGGWCCY 1 cut(s) 330
Psp6I CCWGG 2 cut(s) 246, 332
PspGI CCWGG 2 cut(s) 246, 332
PspPI GGNCC 3 cut(s) 35, 56, 330
PspPPI RGGWCCY 1 cut(s) 330
RsaI GTAC 1 cut(s) 79
RsaNI GTAC 1 cut(s) 78
RseI CAYNNNNRTG 1 cut(s) 153
SacI GAGCTC 1 cut(s) 229
SapI GCTCTTC 1 cut(s) 217
Sau3AI GATC 1 cut(s) 318
Sau96I GGNCC 3 cut(s) 35, 56, 330
ScrFI CCNGG 2 cut(s) 248, 334
SduI GDGCHC 1 cut(s) 229
SetI ASST 6 cut(s) 58, 142, 157, 215, 229, 335
SexAI ACCWGGT 1 cut(s) 332
SfaNI GCATC 1 cut(s) 114
SinI GGWCC 2 cut(s) 56, 330
SmiMI CAYNNNNRTG 1 cut(s) 153
Sse9I AATT 1 cut(s) 4
SstI GAGCTC 1 cut(s) 229
StyD4I CCNGG 2 cut(s) 246, 332
StyI CCWWGG 1 cut(s) 85
TasI AATT 1 cut(s) 4
TfiI GAWTC 1 cut(s) 344
TspDTI ATGAA 2 cut(s) 17, 336
TspGWI ACGGA 1 cut(s) 65
VpaK11BI GGWCC 2 cut(s) 56, 330
XagI CCTNNNNNAGG 1 cut(s) 208
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.