Rh3AG259300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3A
Physical Location & Seq
Reverse (-)
28799568 .. 28821690
22123 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3AG259300.1

Sequence Viewer

Length: 282 bp
ATGATTCAGGCTAAGGAGAAGATTCAACCTGACCAATTCACACTCAATCAAAGGTTGCTCTGCTTGAGTACTGAGATATACAAAGGGAATAGAAAAGCAATTGAAGATGTTGCCAAGAGAAATGACATAGGTTCTGCTAGAAATTGTGAGATCAAGAAAGACAATGAATCTCTTTCGAACATGTCATCTCTTACTATGTCGGTGATAACAATCGAAAGCAAAACAAAGAGGCAGTCGTTCCAAAACGAAGCGCTGCAAAAGAATAAAGAGTTAATGGATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

93

Amino Acids

10.68

Weight (kDa)

8.97

Isoelectric Point (pI)

63.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 70
AfeI AGCGCT 1 cut(s) 252
AflIII ACRYGT 1 cut(s) 180
AgsI TTSAA 2 cut(s) 26, 104
Aor51HI AGCGCT 1 cut(s) 252
ApeKI GCWGC 1 cut(s) 253
ArsI GACNNNNNNTTYG 2 cut(s) 218, 250
AspLEI GCGC 1 cut(s) 253
AsuHPI GGTGA 1 cut(s) 214
AsuII TTCGAA 1 cut(s) 176
BbvI GCAGC 1 cut(s) 240
BfaI CTAG 1 cut(s) 138
BfoI RGCGCY 1 cut(s) 254
BisI GCNGC 1 cut(s) 254
BlsI GCNGC 1 cut(s) 255
BmcAI AGTACT 1 cut(s) 70
Bpu10I CCTNAGC 1 cut(s) 12
Bpu14I TTCGAA 1 cut(s) 176
BpuEI CTTGAG 1 cut(s) 85
BsaBI GATNNNNATC 1 cut(s) 209
Bse8I GATNNNNATC 1 cut(s) 209
BseJI GATNNNNATC 1 cut(s) 209
BseMII CTCAG 1 cut(s) 63
BseXI GCAGC 1 cut(s) 240
Bsp119I TTCGAA 1 cut(s) 176
Bsp143I GATC 1 cut(s) 150
BspCNI CTCAG 1 cut(s) 64
BspT104I TTCGAA 1 cut(s) 176
BssMI GATC 1 cut(s) 150
BstBI TTCGAA 1 cut(s) 176
BstDEI CTNAG 2 cut(s) 12, 72
BstH2I RGCGCY 1 cut(s) 254
BstHHI GCGC 1 cut(s) 253
BstKTI GATC 1 cut(s) 153
BstMBI GATC 1 cut(s) 150
BstNSI RCATGY 1 cut(s) 184
BstV1I GCAGC 1 cut(s) 240
CfoI GCGC 1 cut(s) 253
Csp6I GTAC 1 cut(s) 69
CviAII CATG 1 cut(s) 181
CviJI RGCY 1 cut(s) 11
CviKI_1 RGCY 1 cut(s) 11
CviQI GTAC 1 cut(s) 69
DdeI CTNAG 2 cut(s) 12, 72
DpnI GATC 1 cut(s) 152
DpnII GATC 1 cut(s) 150
Eco47III AGCGCT 1 cut(s) 252
FaeI CATG 1 cut(s) 184
FaiI YATR 4 cut(s) 79, 128, 182, 197
FatI CATG 1 cut(s) 180
Fnu4HI GCNGC 1 cut(s) 254
Fsp4HI GCNGC 1 cut(s) 254
FspBI CTAG 1 cut(s) 138
GlaI GCGC 1 cut(s) 252
GluI GCNGC 1 cut(s) 254
HaeII RGCGCY 1 cut(s) 254
HhaI GCGC 1 cut(s) 253
Hin1II CATG 1 cut(s) 184
Hin6I GCGC 1 cut(s) 251
HinP1I GCGC 1 cut(s) 251
HinfI GANTC 3 cut(s) 4, 22, 167
HphI GGTGA 1 cut(s) 214
Hpy188III TCNNGA 1 cut(s) 154
HpyCH4V TGCA 1 cut(s) 256
HpyF3I CTNAG 2 cut(s) 12, 72
Hsp92II CATG 1 cut(s) 184
HspAI GCGC 1 cut(s) 251
Kzo9I GATC 1 cut(s) 150
LpnPI CCDG 1 cut(s) 42
Lsp1109I GCAGC 1 cut(s) 240
MaeI CTAG 1 cut(s) 138
MalI GATC 1 cut(s) 152
MboI GATC 1 cut(s) 150
MboII GAAGA 2 cut(s) 31, 116
MfeI CAATTG 1 cut(s) 99
MluCI AATT 3 cut(s) 35, 99, 142
MnlI CCTC 1 cut(s) 222
MseI TTAA 1 cut(s) 272
MunI CAATTG 1 cut(s) 99
NdeII GATC 1 cut(s) 150
NlaIII CATG 1 cut(s) 184
NspI RCATGY 1 cut(s) 184
NspV TTCGAA 1 cut(s) 176
PciI ACATGT 1 cut(s) 180
PfeI GAWTC 3 cut(s) 4, 22, 167
PkrI GCNGC 1 cut(s) 255
PscI ACATGT 1 cut(s) 180
RsaI GTAC 1 cut(s) 70
RsaNI GTAC 1 cut(s) 69
SaqAI TTAA 1 cut(s) 272
SatI GCNGC 1 cut(s) 254
Sau3AI GATC 1 cut(s) 150
ScaI AGTACT 1 cut(s) 70
SetI ASST 3 cut(s) 31, 56, 133
SfuI TTCGAA 1 cut(s) 176
SgeI CNNG 7 cut(s) 20, 41, 76, 127, 150, 166, 193
SmlI CTYRAG 1 cut(s) 64
SmoI CTYRAG 1 cut(s) 64
Sse9I AATT 3 cut(s) 35, 99, 142
SspMI CTAG 1 cut(s) 138
TaqI TCGA 2 cut(s) 176, 213
TasI AATT 3 cut(s) 35, 99, 142
TatI WGTACW 1 cut(s) 68
TfiI GAWTC 3 cut(s) 4, 22, 167
Tru1I TTAA 1 cut(s) 272
Tru9I TTAA 1 cut(s) 272
TseI GCWGC 1 cut(s) 253
TspDTI ATGAA 1 cut(s) 180
XceI RCATGY 1 cut(s) 184
XspI CTAG 1 cut(s) 138
ZrmI AGTACT 1 cut(s) 70
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.