RchiOBHm_Chr7g0228801

ATP synthase subunit beta

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
OG0005978
Physical Location & Seq
Forward (+)
52136457 .. 52136693
237 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ20496

Sequence Viewer

Length: 237 bp
ATGGAATTGATCAACAACATTGCCAAAGCTCATGGGGGTGTATCCGTATTTGGCGGAGTGGGTGAACGTACTCGTGAAGGAAATGATCTTTACATGGAAATGAAAGAATCCGGCGTAATTAATGAACAAAATATTCCCGAATCAAAAGTGGCTCTAGTCTATGGTCAAATGAATGAACCGCCCGGAGCTTGTATAAGGGTTGGTTTAACAGCCCTAACTATGGCGGAATATTTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00190 ko00195 ko01100 map00190 map00195 map01100
Pfam Domains
Protein Families
ATP-synt_ab ATP-synt_ab_N

Protein Analysis

78

Amino Acids

8.45

Weight (kDa)

4.78

Isoelectric Point (pI)

40.47

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ATP-synt_ab PF00006 3 - 78 1.1e-11 ATP synthase alpha/beta family, nucleotide-binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 54, 179, 224
AfaI GTAC 1 cut(s) 70
AfiI CCNNNNNNNGG 1 cut(s) 220
AluBI AGCT 2 cut(s) 29, 188
AluI AGCT 2 cut(s) 29, 188
AseI ATTAAT 1 cut(s) 120
AsuC2I CCSGG 1 cut(s) 183
AsuHPI GGTGA 1 cut(s) 74
BauI CACGAG 1 cut(s) 72
BciVI GTATCC 1 cut(s) 52
BclI TGATCA 1 cut(s) 9
BcnI CCSGG 1 cut(s) 183
BfaI CTAG 1 cut(s) 155
BfuI GTATCC 1 cut(s) 52
Bme1390I CCNGG 1 cut(s) 183
BmrFI CCNGG 1 cut(s) 183
BpuMI CCSGG 1 cut(s) 183
Bsc4I CCNNNNNNNGG 1 cut(s) 220
Bse3DI GCAATG 1 cut(s) 18
BseLI CCNNNNNNNGG 1 cut(s) 220
BseMI GCAATG 1 cut(s) 18
BsiSI CCGG 2 cut(s) 111, 183
BslI CCNNNNNNNGG 1 cut(s) 220
Bsp143I GATC 2 cut(s) 9, 85
BspACI CCGC 3 cut(s) 54, 179, 224
BsrDI GCAATG 1 cut(s) 18
BssMI GATC 2 cut(s) 9, 85
BssSI CACGAG 1 cut(s) 72
Bst2BI CACGAG 1 cut(s) 72
BstKTI GATC 2 cut(s) 12, 88
BstMBI GATC 2 cut(s) 9, 85
BstSCI CCNGG 1 cut(s) 181
BsuI GTATCC 1 cut(s) 52
Csp6I GTAC 1 cut(s) 69
CviAII CATG 2 cut(s) 32, 94
CviJI RGCY 4 cut(s) 29, 152, 188, 212
CviKI_1 RGCY 4 cut(s) 29, 152, 188, 212
CviQI GTAC 1 cut(s) 69
DpnI GATC 2 cut(s) 11, 87
DpnII GATC 2 cut(s) 9, 85
EciI GGCGGA 1 cut(s) 69
FaeI CATG 2 cut(s) 35, 97
FaiI YATR 5 cut(s) 33, 95, 162, 194, 221
FatI CATG 2 cut(s) 31, 93
FbaI TGATCA 1 cut(s) 9
FspBI CTAG 1 cut(s) 155
HapII CCGG 2 cut(s) 111, 183
Hin1II CATG 2 cut(s) 35, 97
HinfI GANTC 2 cut(s) 107, 140
HpaII CCGG 2 cut(s) 111, 183
HphI GGTGA 1 cut(s) 74
Hpy166II GTNNAC 1 cut(s) 65
Hpy188I TCNGA 1 cut(s) 236
Hpy188III TCNNGA 2 cut(s) 74, 137
Hpy8I GTNNAC 1 cut(s) 65
HpyAV CCTTC 1 cut(s) 71
HpyCH4IV ACGT 1 cut(s) 67
HpySE526I ACGT 1 cut(s) 67
Hsp92II CATG 2 cut(s) 35, 97
Ksp22I TGATCA 1 cut(s) 9
Kzo9I GATC 2 cut(s) 9, 85
LmnI GCTCC 1 cut(s) 185
LpnPI CCDG 2 cut(s) 124, 196
MaeI CTAG 1 cut(s) 155
MaeII ACGT 1 cut(s) 67
MalI GATC 2 cut(s) 11, 87
MboI GATC 2 cut(s) 9, 85
MluCI AATT 2 cut(s) 5, 117
MseI TTAA 2 cut(s) 120, 206
MslI CAYNNNNRTG 2 cut(s) 36, 98
MspI CCGG 2 cut(s) 111, 183
MspR9I CCNGG 1 cut(s) 183
NciI CCSGG 1 cut(s) 183
NdeII GATC 2 cut(s) 9, 85
NlaIII CATG 2 cut(s) 35, 97
PfeI GAWTC 2 cut(s) 107, 140
PshBI ATTAAT 1 cut(s) 120
RsaI GTAC 1 cut(s) 70
RsaNI GTAC 1 cut(s) 69
RseI CAYNNNNRTG 2 cut(s) 36, 98
SaqAI TTAA 2 cut(s) 120, 206
Sau3AI GATC 2 cut(s) 9, 85
ScrFI CCNGG 1 cut(s) 183
SetI ASST 3 cut(s) 31, 70, 190
SmiMI CAYNNNNRTG 2 cut(s) 36, 98
Sse9I AATT 2 cut(s) 5, 117
SsiI CCGC 3 cut(s) 54, 179, 224
SspI AATATT 2 cut(s) 133, 230
SspMI CTAG 1 cut(s) 155
StyD4I CCNGG 1 cut(s) 181
TaiI ACGT 1 cut(s) 70
TasI AATT 2 cut(s) 5, 117
TfiI GAWTC 2 cut(s) 107, 140
Tru1I TTAA 2 cut(s) 120, 206
Tru9I TTAA 2 cut(s) 120, 206
TspDTI ATGAA 4 cut(s) 116, 138, 185, 189
TspGWI ACGGA 1 cut(s) 34
VspI ATTAAT 1 cut(s) 120
XspI CTAG 1 cut(s) 155
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.