RchiOBHm_Chr7g0236081

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Reverse (-)
60966261 .. 60967143
883 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ21157

Sequence Viewer

Length: 198 bp
ATGGTCAGGAATGGTCTTTGGGTACATTTGGATGATATTCTTTCTCTTCATAGTCTTCCTTCAATGCTGGTAGGAAACGTCAACAATTATGCGTCTGTAAAATATGGAGGTGTTGCATTTGGACTTGCTTGCTGGATGGATTCGAACTACTTAATTCACCTAGGGTTTATTGCATCGTCTCAAGACTGCCTGGTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

65

Amino Acids

7.13

Weight (kDa)

5.71

Isoelectric Point (pI)

52.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 24
AgsI TTSAA 1 cut(s) 63
AjnI CCWGG 1 cut(s) 189
Alw26I GTCTC 1 cut(s) 183
AspA2I CCTAGG 1 cut(s) 160
AsuHPI GGTGA 1 cut(s) 149
AsuII TTCGAA 1 cut(s) 143
AvrII CCTAGG 1 cut(s) 160
BbsI GAAGAC 1 cut(s) 47
BccI CCATC 1 cut(s) 130
BciT130I CCWGG 1 cut(s) 191
BcoDI GTCTC 1 cut(s) 183
BfaI CTAG 1 cut(s) 161
BlnI CCTAGG 1 cut(s) 160
Bme1390I CCNGG 1 cut(s) 191
BmrFI CCNGG 1 cut(s) 191
BmsI GCATC 1 cut(s) 182
BpiI GAAGAC 1 cut(s) 47
Bpu14I TTCGAA 1 cut(s) 143
BpuEI CTTGAG 1 cut(s) 165
BsaJI CCNNGG 1 cut(s) 160
BseBI CCWGG 1 cut(s) 191
BseDI CCNNGG 1 cut(s) 160
BseGI GGATG 2 cut(s) 37, 141
BsmAI GTCTC 1 cut(s) 183
BsmBI CGTCTC 1 cut(s) 183
Bsp119I TTCGAA 1 cut(s) 143
BspT104I TTCGAA 1 cut(s) 143
BssECI CCNNGG 1 cut(s) 160
BssT1I CCWWGG 1 cut(s) 160
Bst2UI CCWGG 1 cut(s) 191
Bst6I CTCTTC 1 cut(s) 51
BstBI TTCGAA 1 cut(s) 143
BstC8I GCNNGC 1 cut(s) 130
BstF5I GGATG 2 cut(s) 37, 141
BstMAI GTCTC 1 cut(s) 183
BstNI CCWGG 1 cut(s) 191
BstSCI CCNGG 1 cut(s) 189
BstV2I GAAGAC 1 cut(s) 47
BtsCI GGATG 2 cut(s) 37, 141
Cac8I GCNNGC 1 cut(s) 130
CseI GACGC 1 cut(s) 81
Csp6I GTAC 1 cut(s) 23
CviQI GTAC 1 cut(s) 23
Eam1104I CTCTTC 1 cut(s) 51
EarI CTCTTC 1 cut(s) 51
Eco130I CCWWGG 1 cut(s) 160
EcoRII CCWGG 1 cut(s) 189
EcoT14I CCWWGG 1 cut(s) 160
ErhI CCWWGG 1 cut(s) 160
Esp3I CGTCTC 1 cut(s) 183
FaiI YATR 3 cut(s) 51, 90, 105
FokI GGATG 2 cut(s) 44, 148
FspBI CTAG 1 cut(s) 161
HgaI GACGC 1 cut(s) 81
HincII GTYRAC 1 cut(s) 82
HindII GTYRAC 1 cut(s) 82
HinfI GANTC 1 cut(s) 140
HphI GGTGA 1 cut(s) 149
Hpy166II GTNNAC 1 cut(s) 82
Hpy188III TCNNGA 2 cut(s) 7, 182
Hpy8I GTNNAC 1 cut(s) 82
HpyAV CCTTC 1 cut(s) 69
HpyCH4IV ACGT 1 cut(s) 78
HpyCH4V TGCA 2 cut(s) 116, 173
HpySE526I ACGT 1 cut(s) 78
LpnPI CCDG 3 cut(s) 53, 118, 176
LweI GCATC 1 cut(s) 182
MaeI CTAG 1 cut(s) 161
MaeII ACGT 1 cut(s) 78
MboII GAAGA 2 cut(s) 38, 47
MluCI AATT 2 cut(s) 85, 153
MnlI CCTC 1 cut(s) 101
MseI TTAA 2 cut(s) 152, 196
MslI CAYNNNNRTG 1 cut(s) 30
MspR9I CCNGG 1 cut(s) 191
MvaI CCWGG 1 cut(s) 191
NspV TTCGAA 1 cut(s) 143
PfeI GAWTC 1 cut(s) 140
Psp6I CCWGG 1 cut(s) 189
PspGI CCWGG 1 cut(s) 189
RsaI GTAC 1 cut(s) 24
RsaNI GTAC 1 cut(s) 23
RseI CAYNNNNRTG 1 cut(s) 30
SaqAI TTAA 2 cut(s) 152, 196
ScrFI CCNGG 1 cut(s) 191
SetI ASST 3 cut(s) 81, 112, 162
SfaNI GCATC 1 cut(s) 182
SfuI TTCGAA 1 cut(s) 143
SgeI CNNG 7 cut(s) 19, 80, 137, 141, 145, 173, 194
SmiMI CAYNNNNRTG 1 cut(s) 30
SmlI CTYRAG 1 cut(s) 180
SmoI CTYRAG 1 cut(s) 180
Sse9I AATT 2 cut(s) 85, 153
SspMI CTAG 1 cut(s) 161
StyD4I CCNGG 1 cut(s) 189
StyI CCWWGG 1 cut(s) 160
TaiI ACGT 1 cut(s) 81
TaqI TCGA 1 cut(s) 143
TasI AATT 2 cut(s) 85, 153
TfiI GAWTC 1 cut(s) 140
Tru1I TTAA 2 cut(s) 152, 196
Tru9I TTAA 2 cut(s) 152, 196
TspDTI ATGAA 1 cut(s) 38
XmaJI CCTAGG 1 cut(s) 160
XspI CTAG 1 cut(s) 161
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.