Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002449.1

Orthogroup ID

OG0004860

Physical Location & Seq

Genomic Coordinates Reverse (-)

60063 .. 61883

Gene Structure 1821 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002449.1_g000017.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 705 bp

atgggcgattctgggtttgatgtttcagggttgaatctcatctcggaggttgcggatcttgcagcctttgattccaacacaagggcttcttcttcttctttgaaatcttgccatgttgttgcgattcagatgttgatggagttcaagattatgaagaagaaaggcttgcaggccgcacatctggacaagaacttcttcattcccaagaagaaaaagtctaatctttctctttttatttctttttctaagaggactgacttgttggctttccatatacccaaaaagaaaagatctaatcttgtttctcacatgatgaaaaggaagagatctggggagaaagatggtcaaattccaaggctaaagaggcggagaactattactggagatgacttggccatgccttctcgttctcatcaagaaatcaaaaacaagattagcagccacgtcccactctggtcattccaaaggaaatccccgcttcgattttccctcatcaagcttcatctatctgctactaggacaactgcggttaggttagggtttcgagtattccaagttgtgcggcaccctaggttcatggctgcagcgatcgcttccatgactgccagactggcgaccaagttgtcgctcaaggaagaagaagaaccggttgacttggggaatctcaaggtttcggggaaggagtttttggctcggaatttctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

234

Amino Acids

26.46

Weight (kDa)

10.85

Isoelectric Point (pI)

47.26

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004860)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_5g35081 FvH4_5g35082 FvH4_5g35230
rosa_chinensis	RchiOBHm_Chr0c11g0499531 RchiOBHm_Chr7g0236081 RchiOBHm_Chr7g0236361
rosa_multiflora	Rmu_sc0002449.1_g000017
rosa_roxburghii	Rroxscaffold_3G00225120 Rroxscaffold_3G00225130 Rroxscaffold_3G00225150 Rroxscaffold_3G00225160 Rroxscaffold_3G00225180 Rroxscaffold_3G00225200 Rroxscaffold_3G00225430 Rroxscaffold_3G00225440
rosa_rugosa	Rorug07G0117500 Rorug07G0286400 Rorug07G0293500 Rorug07G0293600 Rorug07G0296800
rosa_samantha	Rh1DG165500 Rh5DG246000 Rh7AG448400 Rh7AG448500 Rh7AG448900 Rh7AG449000 Rh7AG449100 Rh7AG449200
rosa_wichuraiana	Rw0G007960 Rw0G019900 Rw5G021720

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	622
AccB1I	GGYRCC	1 cut(s)	564
AciI	CCGC	6 cut(s)	53, 174, 367, 476, 527, 562
AclWI	GGATC	1 cut(s)	63
AcoI	YGGCCR	1 cut(s)	393
AcsI	RAATTY	2 cut(s)	348, 697
AfiI	CCNNNNNNNGG	1 cut(s)	81
AgeI	ACCGGT	1 cut(s)	646
AgsI	TTSAA	3 cut(s)	34, 103, 145
AjiI	CACGTC	1 cut(s)	445
AjuI	GAANNNNNNNTTGG	2 cut(s)	671, 703
AluBI	AGCT	1 cut(s)	499
AluI	AGCT	1 cut(s)	499
AlwI	GGATC	1 cut(s)	63
AoxI	GGCC	2 cut(s)	171, 393
ApeKI	GCWGC	4 cut(s)	62, 438, 581, 584
ApoI	RAATTY	2 cut(s)	348, 697
AsiGI	ACCGGT	1 cut(s)	646
AsiSI	GCGATCGC	1 cut(s)	591
Asp700I	GAANNNNTTC	1 cut(s)	194
AspA2I	CCTAGG	1 cut(s)	569
AvrII	CCTAGG	1 cut(s)	569
BalI	TGGCCA	1 cut(s)	395
BanI	GGYRCC	1 cut(s)	564
BbvI	GCAGC	4 cut(s)	74, 450, 568, 596
BccI	CCATC	2 cut(s)	130, 335
BfaI	CTAG	3 cut(s)	516, 570, 703
BfmI	CTRYAG	1 cut(s)	582
BglI	GCCNNNNNGGC	1 cut(s)	611
BglII	AGATCT	2 cut(s)	290, 326
BisI	GCNGC	6 cut(s)	63, 174, 439, 563, 582, 585
BlnI	CCTAGG	1 cut(s)	569
BlsI	GCNGC	6 cut(s)	64, 175, 440, 564, 583, 586
BmgBI	CACGTC	1 cut(s)	445
BmiI	GGNNCC	1 cut(s)	566
BpmI	CTGGAG	1 cut(s)	402
BpuEI	CTTGAG	2 cut(s)	614, 650
BsaJI	CCNNGG	2 cut(s)	353, 569
BsaWI	WCCGGW	1 cut(s)	646
Bsc4I	CCNNNNNNNGG	1 cut(s)	81
Bse118I	RCCGGY	1 cut(s)	646
Bse1I	ACTGG	2 cut(s)	385, 615
BseDI	CCNNGG	2 cut(s)	353, 569
BseLI	CCNNNNNNNGG	1 cut(s)	81
BseNI	ACTGG	2 cut(s)	385, 615
BseXI	GCAGC	4 cut(s)	74, 450, 568, 596
Bsh1285I	CGRYCG	1 cut(s)	591
BshFI	GGCC	2 cut(s)	173, 395
BshNI	GGYRCC	1 cut(s)	564
BshTI	ACCGGT	1 cut(s)	646
BsiEI	CGRYCG	1 cut(s)	591
BsiSI	CCGG	1 cut(s)	647
BslFI	GGGAC	1 cut(s)	431
BslI	CCNNNNNNNGG	1 cut(s)	81
BsmFI	GGGAC	1 cut(s)	431
BsnI	GGCC	2 cut(s)	173, 395
Bsp143I	GATC	4 cut(s)	55, 290, 326, 588
BspACI	CCGC	6 cut(s)	53, 174, 367, 476, 527, 562
BspANI	GGCC	2 cut(s)	173, 395
BspLI	GGNNCC	1 cut(s)	566
BspMAI	CTGCAG	1 cut(s)	586
BspPI	GGATC	1 cut(s)	63
BspT107I	GGYRCC	1 cut(s)	564
BsrFI	RCCGGY	1 cut(s)	646
BsrI	ACTGG	2 cut(s)	385, 615
BssAI	RCCGGY	1 cut(s)	646
BssECI	CCNNGG	2 cut(s)	353, 569
BssMI	GATC	4 cut(s)	55, 290, 326, 588
BssT1I	CCWWGG	2 cut(s)	353, 569
Bst6I	CTCTTC	1 cut(s)	317
BstC8I	GCNNGC	2 cut(s)	167, 171
BstDEI	CTNAG	1 cut(s)	246
BstKTI	GATC	4 cut(s)	58, 293, 329, 591
BstMBI	GATC	4 cut(s)	55, 290, 326, 588
BstMCI	CGRYCG	1 cut(s)	591
BstMWI	GCNNNNNNNGC	4 cut(s)	59, 364, 590, 611
BstSFI	CTRYAG	1 cut(s)	582
BstV1I	GCAGC	4 cut(s)	74, 450, 568, 596
BstX2I	RGATCY	3 cut(s)	55, 290, 326
BstYI	RGATCY	3 cut(s)	55, 290, 326
BsuRI	GGCC	2 cut(s)	173, 395
BtrI	CACGTC	1 cut(s)	445
Cac8I	GCNNGC	2 cut(s)	167, 171
Cfr10I	RCCGGY	1 cut(s)	646
CspAI	ACCGGT	1 cut(s)	646
CviAII	CATG	5 cut(s)	113, 310, 397, 577, 598
DdeI	CTNAG	1 cut(s)	246
DpnI	GATC	4 cut(s)	57, 292, 328, 590
DpnII	GATC	4 cut(s)	55, 290, 326, 588
DrdI	GACNNNNNNGTC	1 cut(s)	622
DseDI	GACNNNNNNGTC	1 cut(s)	622
EaeI	YGGCCR	1 cut(s)	393
Eam1104I	CTCTTC	1 cut(s)	317
EarI	CTCTTC	1 cut(s)	317
EciI	GGCGGA	1 cut(s)	382
Eco130I	CCWWGG	2 cut(s)	353, 569
EcoT14I	CCWWGG	2 cut(s)	353, 569
ErhI	CCWWGG	2 cut(s)	353, 569
FaeI	CATG	5 cut(s)	116, 313, 400, 580, 601
FaiI	YATR	8 cut(s)	114, 152, 273, 275, 311, 398, 578, 599
FalI	AAGNNNNNCTT	6 cut(s)	73, 105, 149, 181, 179, 211
FaqI	GGGAC	1 cut(s)	431
FatI	CATG	5 cut(s)	112, 309, 396, 576, 597
FauI	CCCGC	1 cut(s)	483
Fnu4HI	GCNGC	6 cut(s)	63, 174, 439, 563, 582, 585
Fsp4HI	GCNGC	6 cut(s)	63, 174, 439, 563, 582, 585
FspBI	CTAG	3 cut(s)	516, 570, 703
GluI	GCNGC	6 cut(s)	63, 174, 439, 563, 582, 585
GsuI	CTGGAG	1 cut(s)	402
HaeIII	GGCC	2 cut(s)	173, 395
HapII	CCGG	1 cut(s)	647
Hin1II	CATG	5 cut(s)	116, 313, 400, 580, 601
HincII	GTYRAC	1 cut(s)	652
HindII	GTYRAC	1 cut(s)	652
HindIII	AAGCTT	1 cut(s)	497
HinfI	GANTC	5 cut(s)	8, 34, 71, 124, 661
HpaII	CCGG	1 cut(s)	647
Hpy166II	GTNNAC	1 cut(s)	652
Hpy188I	TCNGA	3 cut(s)	46, 129, 696
Hpy188III	TCNNGA	3 cut(s)	145, 182, 416
Hpy8I	GTNNAC	1 cut(s)	652
HpyAV	CCTTC	2 cut(s)	411, 673
HpyCH4IV	ACGT	1 cut(s)	444
HpyCH4V	TGCA	3 cut(s)	62, 169, 584
HpyF10VI	GCNNNNNNNGC	4 cut(s)	59, 364, 590, 611
HpyF3I	CTNAG	1 cut(s)	246
HpySE526I	ACGT	1 cut(s)	444
Hsp92II	CATG	5 cut(s)	116, 313, 400, 580, 601
Kzo9I	GATC	4 cut(s)	55, 290, 326, 588
LpnPI	CCDG	9 cut(s)	12, 155, 167, 315, 366, 439, 596, 619, 660
Lsp1109I	GCAGC	4 cut(s)	74, 450, 568, 596
MaeI	CTAG	3 cut(s)	516, 570, 703
MaeII	ACGT	1 cut(s)	444
MalI	GATC	4 cut(s)	57, 292, 328, 590
MboI	GATC	4 cut(s)	55, 290, 326, 588
MflI	RGATCY	3 cut(s)	55, 290, 326
MlsI	TGGCCA	1 cut(s)	395
MluCI	AATT	2 cut(s)	348, 697
MluNI	TGGCCA	1 cut(s)	395
MmeI	TCCRAC	1 cut(s)	99
MnlI	CCTC	4 cut(s)	40, 243, 357, 500
Mox20I	TGGCCA	1 cut(s)	395
MroXI	GAANNNNTTC	1 cut(s)	194
MscI	TGGCCA	1 cut(s)	395
Msp20I	TGGCCA	1 cut(s)	395
MspI	CCGG	1 cut(s)	647
MwoI	GCNNNNNNNGC	4 cut(s)	59, 364, 590, 611
NdeII	GATC	4 cut(s)	55, 290, 326, 588
NlaIII	CATG	5 cut(s)	116, 313, 400, 580, 601
NlaIV	GGNNCC	1 cut(s)	566
PdmI	GAANNNNTTC	1 cut(s)	194
PfeI	GAWTC	5 cut(s)	8, 34, 71, 124, 661
PinAI	ACCGGT	1 cut(s)	646
PkrI	GCNGC	6 cut(s)	64, 175, 440, 564, 583, 586
Ple19I	CGATCG	1 cut(s)	591
PspN4I	GGNNCC	1 cut(s)	566
PstI	CTGCAG	1 cut(s)	586
PsuI	RGATCY	3 cut(s)	55, 290, 326
PvuI	CGATCG	1 cut(s)	591
RgaI	GCGATCGC	1 cut(s)	591
SatI	GCNGC	6 cut(s)	63, 174, 439, 563, 582, 585
Sau3AI	GATC	4 cut(s)	55, 290, 326, 588
SetI	ASST	6 cut(s)	51, 447, 501, 536, 575, 672
SfaAI	GCGATCGC	1 cut(s)	591
SfcI	CTRYAG	1 cut(s)	582
SgfI	GCGATCGC	1 cut(s)	591
SmlI	CTYRAG	2 cut(s)	629, 665
SmoI	CTYRAG	2 cut(s)	629, 665
Sse9I	AATT	2 cut(s)	348, 697
SsiI	CCGC	6 cut(s)	53, 174, 367, 476, 527, 562
SspMI	CTAG	3 cut(s)	516, 570, 703
StyI	CCWWGG	2 cut(s)	353, 569
TaiI	ACGT	1 cut(s)	447
TaqI	TCGA	2 cut(s)	481, 544
TasI	AATT	2 cut(s)	348, 697
TauI	GCSGC	2 cut(s)	176, 565
TfiI	GAWTC	5 cut(s)	8, 34, 71, 124, 661
TseI	GCWGC	4 cut(s)	62, 438, 581, 584
TspDTI	ATGAA	5 cut(s)	167, 187, 329, 491, 565
XapI	RAATTY	2 cut(s)	348, 697
XmaJI	CCTAGG	1 cut(s)	569
XmnI	GAANNNNTTC	1 cut(s)	194
XspI	CTAG	3 cut(s)	516, 570, 703

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.