RLG00000003048

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr1
OG0016406
Physical Location & Seq
Reverse (-)
43620692 .. 43621279
588 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000003048

Sequence Viewer

Length: 477 bp
ATGGCTGACAACGAAAAGATTCAAAAGGAAAAGCTAAAGAAGAAACTAAAGGAGTTAAAAACTATAATGGCGGAGCAGGATGGTCGCCTCAATCATCTGCAATCAAGTGGGTTTCAACTTGCGAACTTCTATTTCGTCTTTCAGGGAGTTATTTTGACGGAATATCTTGAAACCATCAAACAGCGAGACAATTCGTTGATGAAGATCGATAGGAAGAATGCCGATTTGAAGAAATTTAAAAACAAGCTTGGTCCACCTGATGTTCCGCCTTATGTTGATGCTTATAAAAAGTTCAAGCGTAAATTCTCCTTTGTTATTTGCGTGCTTCTATTTCTGGTCTTTTCCAGCATCATGATTGCCGCTTGCTGGACTGTTATTTGCCATCCAGCAGCTAAATCTAAGCACACACCGACCGTTGATGGTAAGTGCATTAGGCTTTGTGATAGTTCCAATTGTATAAGGATCTGCAGCGAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

159

Amino Acids

18.18

Weight (kDa)

9.46

Isoelectric Point (pI)

31.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 285
AciI CCGC 3 cut(s) 71, 266, 360
AclWI GGATC 1 cut(s) 470
AcsI RAATTY 2 cut(s) 233, 302
AfiI CCNNNNNNNGG 1 cut(s) 366
AgsI TTSAA 5 cut(s) 23, 116, 170, 229, 295
AluBI AGCT 3 cut(s) 34, 247, 392
AluI AGCT 3 cut(s) 34, 247, 392
Alw26I GTCTC 1 cut(s) 180
AlwI GGATC 1 cut(s) 470
ApeKI GCWGC 2 cut(s) 389, 468
ApoI RAATTY 2 cut(s) 233, 302
Asp700I GAANNNNTTC 1 cut(s) 18
AspS9I GGNCC 1 cut(s) 251
AvaII GGWCC 1 cut(s) 251
BbvI GCAGC 1 cut(s) 401
BccI CCATC 4 cut(s) 74, 182, 390, 413
BcgI CGANNNNNNTGC 2 cut(s) 65, 99
BcoDI GTCTC 1 cut(s) 180
BfmI CTRYAG 1 cut(s) 466
BisI GCNGC 3 cut(s) 360, 390, 469
BlsI GCNGC 3 cut(s) 361, 391, 470
Bme18I GGWCC 1 cut(s) 251
BmgT120I GGNCC 1 cut(s) 251
BmsI GCATC 2 cut(s) 268, 357
Bsa29I ATCGAT 1 cut(s) 207
BsaBI GATNNNNATC 1 cut(s) 203
Bsc4I CCNNNNNNNGG 1 cut(s) 366
Bse8I GATNNNNATC 1 cut(s) 203
BseCI ATCGAT 1 cut(s) 207
BseGI GGATG 2 cut(s) 85, 382
BseJI GATNNNNATC 1 cut(s) 203
BseLI CCNNNNNNNGG 1 cut(s) 366
BseXI GCAGC 1 cut(s) 401
Bsh1285I CGRYCG 1 cut(s) 414
BshVI ATCGAT 1 cut(s) 207
BsiEI CGRYCG 1 cut(s) 414
BslI CCNNNNNNNGG 1 cut(s) 366
BsmAI GTCTC 1 cut(s) 180
BsmI GAATGC 1 cut(s) 223
Bsp143I GATC 2 cut(s) 204, 462
BspACI CCGC 3 cut(s) 71, 266, 360
BspDI ATCGAT 1 cut(s) 207
BspHI TCATGA 1 cut(s) 351
BspMAI CTGCAG 1 cut(s) 470
BspPI GGATC 1 cut(s) 470
BssMI GATC 2 cut(s) 204, 462
Bst4CI ACNGT 2 cut(s) 373, 415
BstC8I GCNNGC 2 cut(s) 323, 364
BstDEI CTNAG 1 cut(s) 399
BstF5I GGATG 2 cut(s) 85, 382
BstKTI GATC 2 cut(s) 207, 465
BstMAI GTCTC 1 cut(s) 180
BstMBI GATC 2 cut(s) 204, 462
BstMCI CGRYCG 1 cut(s) 414
BstSFI CTRYAG 1 cut(s) 466
BstV1I GCAGC 1 cut(s) 401
BstX2I RGATCY 1 cut(s) 462
BstYI RGATCY 1 cut(s) 462
Bsu15I ATCGAT 1 cut(s) 207
BsuTUI ATCGAT 1 cut(s) 207
BtsCI GGATG 2 cut(s) 85, 382
Cac8I GCNNGC 2 cut(s) 323, 364
CciI TCATGA 1 cut(s) 351
Cfr13I GGNCC 1 cut(s) 251
ClaI ATCGAT 1 cut(s) 207
CviAII CATG 1 cut(s) 352
CviJI RGCY 5 cut(s) 5, 34, 247, 392, 436
CviKI_1 RGCY 5 cut(s) 5, 34, 247, 392, 436
DdeI CTNAG 1 cut(s) 399
DpnI GATC 2 cut(s) 206, 464
DpnII GATC 2 cut(s) 204, 462
DraI TTTAAA 1 cut(s) 238
EciI GGCGGA 2 cut(s) 86, 255
Eco47I GGWCC 1 cut(s) 251
FaeI CATG 1 cut(s) 355
FaiI YATR 5 cut(s) 65, 273, 285, 353, 458
FatI CATG 1 cut(s) 351
Fnu4HI GCNGC 3 cut(s) 360, 390, 469
FokI GGATG 2 cut(s) 92, 369
Fsp4HI GCNGC 3 cut(s) 360, 390, 469
GluI GCNGC 3 cut(s) 360, 390, 469
Hin1II CATG 1 cut(s) 355
HindIII AAGCTT 1 cut(s) 245
HinfI GANTC 1 cut(s) 19
Hpy166II GTNNAC 1 cut(s) 254
Hpy188III TCNNGA 2 cut(s) 167, 352
Hpy8I GTNNAC 1 cut(s) 254
HpyCH4III ACNGT 2 cut(s) 373, 415
HpyCH4V TGCA 3 cut(s) 100, 429, 468
HpyF3I CTNAG 1 cut(s) 399
Hsp92II CATG 1 cut(s) 355
Kzo9I GATC 2 cut(s) 204, 462
LmnI GCTCC 1 cut(s) 73
LpnPI CCDG 7 cut(s) 62, 128, 270, 320, 352, 358, 399
Lsp1109I GCAGC 1 cut(s) 401
LweI GCATC 2 cut(s) 268, 357
MalI GATC 2 cut(s) 206, 464
MboI GATC 2 cut(s) 204, 462
MboII GAAGA 4 cut(s) 52, 214, 226, 241
MfeI CAATTG 1 cut(s) 451
MflI RGATCY 1 cut(s) 462
MluCI AATT 4 cut(s) 190, 233, 302, 451
MnlI CCTC 1 cut(s) 98
MroXI GAANNNNTTC 1 cut(s) 18
MseI TTAA 2 cut(s) 56, 237
MunI CAATTG 1 cut(s) 451
Mva1269I GAATGC 1 cut(s) 223
NdeII GATC 2 cut(s) 204, 462
NlaIII CATG 1 cut(s) 355
PagI TCATGA 1 cut(s) 351
PctI GAATGC 1 cut(s) 223
PdmI GAANNNNTTC 1 cut(s) 18
PfeI GAWTC 1 cut(s) 19
PkrI GCNGC 3 cut(s) 361, 391, 470
PsiI TTATAA 1 cut(s) 285
PspPI GGNCC 1 cut(s) 251
PstI CTGCAG 1 cut(s) 470
PsuI RGATCY 1 cut(s) 462
SaqAI TTAA 2 cut(s) 56, 237
SatI GCNGC 3 cut(s) 360, 390, 469
Sau3AI GATC 2 cut(s) 204, 462
Sau96I GGNCC 1 cut(s) 251
SetI ASST 4 cut(s) 36, 249, 259, 394
SfaNI GCATC 2 cut(s) 268, 357
SfcI CTRYAG 1 cut(s) 466
SinI GGWCC 1 cut(s) 251
Sse9I AATT 4 cut(s) 190, 233, 302, 451
SsiI CCGC 3 cut(s) 71, 266, 360
TaaI ACNGT 2 cut(s) 373, 415
TaqI TCGA 1 cut(s) 207
TasI AATT 4 cut(s) 190, 233, 302, 451
TauI GCSGC 1 cut(s) 362
TfiI GAWTC 1 cut(s) 19
Tru1I TTAA 2 cut(s) 56, 237
Tru9I TTAA 2 cut(s) 56, 237
TseI GCWGC 2 cut(s) 389, 468
TspDTI ATGAA 1 cut(s) 215
TspGWI ACGGA 1 cut(s) 173
VpaK11BI GGWCC 1 cut(s) 251
XapI RAATTY 2 cut(s) 233, 302
XmnI GAANNNNTTC 1 cut(s) 18
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.