RLG00000007426

seed maturation protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr2
OG0009388
Physical Location & Seq
Forward (+)
16641736 .. 16646332
4597 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000007426

Sequence Viewer

Length: 333 bp
ATGGGTAGATTTGCTAATAGTGAGCCGTTAAGCTCAAACAAATTGGGTGGATGGTTACTAAGCGAGGTTGGACGTGCCTTGCTCTGTGTACCAAGAGAGCTTTACCCATTGCCTGGGGAGGGCTCCAAAACCCCACCGGAACTAGAAGAGGTTTGTCAAAGATGGGGCAATGATGGCTTCGGTAACTACTGTTCTGCACTCCGAAGCATTGCTGACCAGCGTTTGTTGAAGGCCACAGATGATGAAGTGAGTAAAGCTGAAGTGACACTCCTGCGTGTTCTTGAATATGAGGTTGAGTTCTGGAACATGAGCCGTGGGATTCCTGGGTACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005829 GO:0044424 GO:0044444 GO:0044464
KEGG Pathways
Metabolic & Signaling
ko00730 ko01100 map00730 map01100
Pfam Domains
Protein Families
TENA_THI-4

Protein Analysis

111

Amino Acids

12.28

Weight (kDa)

4.85

Isoelectric Point (pI)

40.57

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TENA_THI-4 PF03070 43 - 105 1.9e-08 TENA/THI-4/PQQC family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 113
AcuI CTGAAG 1 cut(s) 279
AfaI GTAC 2 cut(s) 90, 329
AfiI CCNNNNNNNGG 2 cut(s) 113, 119
AgsI TTSAA 2 cut(s) 229, 284
AjiI CACGTC 1 cut(s) 74
AjnI CCWGG 2 cut(s) 112, 322
AluBI AGCT 3 cut(s) 33, 100, 257
AluI AGCT 3 cut(s) 33, 100, 257
AoxI GGCC 1 cut(s) 231
BanII GRGCYC 1 cut(s) 125
BccI CCATC 3 cut(s) 45, 156, 167
BceAI ACGGC 2 cut(s) 10, 297
BciT130I CCWGG 2 cut(s) 114, 324
BfaI CTAG 2 cut(s) 143, 331
Bme1390I CCNGG 2 cut(s) 114, 324
BmgBI CACGTC 1 cut(s) 74
BmiI GGNNCC 1 cut(s) 124
BmrFI CCNGG 2 cut(s) 114, 324
BsaJI CCNNGG 3 cut(s) 113, 313, 323
BsaWI WCCGGW 1 cut(s) 136
Bsc4I CCNNNNNNNGG 2 cut(s) 113, 119
Bse3DI GCAATG 3 cut(s) 107, 175, 207
BseBI CCWGG 2 cut(s) 114, 324
BseDI CCNNGG 3 cut(s) 113, 313, 323
BseGI GGATG 1 cut(s) 56
BseLI CCNNNNNNNGG 2 cut(s) 113, 119
BseMI GCAATG 3 cut(s) 107, 175, 207
BsgI GTGCAG 1 cut(s) 180
BshFI GGCC 1 cut(s) 233
BsiSI CCGG 1 cut(s) 137
BslI CCNNNNNNNGG 2 cut(s) 113, 119
BsnI GGCC 1 cut(s) 233
Bsp1286I GDGCHC 1 cut(s) 125
BspANI GGCC 1 cut(s) 233
BspLI GGNNCC 1 cut(s) 124
BsrDI GCAATG 3 cut(s) 107, 175, 207
BssECI CCNNGG 3 cut(s) 113, 313, 323
Bst2UI CCWGG 2 cut(s) 114, 324
Bst4CI ACNGT 1 cut(s) 191
Bst6I CTCTTC 1 cut(s) 141
BstDEI CTNAG 1 cut(s) 59
BstDSI CCRYGG 1 cut(s) 313
BstF5I GGATG 1 cut(s) 56
BstMWI GCNNNNNNNGC 1 cut(s) 174
BstNI CCWGG 2 cut(s) 114, 324
BstSCI CCNGG 2 cut(s) 112, 322
BsuRI GGCC 1 cut(s) 233
BtgI CCRYGG 1 cut(s) 313
BtrI CACGTC 1 cut(s) 74
BtsCI GGATG 1 cut(s) 56
Csp6I GTAC 2 cut(s) 89, 328
CspCI CAANNNNNGTGG 2 cut(s) 28, 63
CviAII CATG 1 cut(s) 307
CviJI RGCY 8 cut(s) 25, 33, 100, 123, 177, 233, 257, 312
CviKI_1 RGCY 8 cut(s) 25, 33, 100, 123, 177, 233, 257, 312
CviQI GTAC 2 cut(s) 89, 328
DdeI CTNAG 1 cut(s) 59
Eam1104I CTCTTC 1 cut(s) 141
EarI CTCTTC 1 cut(s) 141
Eco24I GRGCYC 1 cut(s) 125
Eco57I CTGAAG 1 cut(s) 279
EcoRII CCWGG 2 cut(s) 112, 322
EcoT38I GRGCYC 1 cut(s) 125
FaeI CATG 1 cut(s) 310
FaiI YATR 2 cut(s) 288, 308
FatI CATG 1 cut(s) 306
FokI GGATG 1 cut(s) 63
FriOI GRGCYC 1 cut(s) 125
FspBI CTAG 2 cut(s) 143, 331
HaeIII GGCC 1 cut(s) 233
HapII CCGG 1 cut(s) 137
Hin1II CATG 1 cut(s) 310
HinfI GANTC 1 cut(s) 319
HpaII CCGG 1 cut(s) 137
Hpy166II GTNNAC 1 cut(s) 89
Hpy188I TCNGA 1 cut(s) 203
Hpy188III TCNNGA 2 cut(s) 281, 301
Hpy8I GTNNAC 1 cut(s) 89
HpyAV CCTTC 1 cut(s) 223
HpyCH4III ACNGT 1 cut(s) 191
HpyCH4IV ACGT 1 cut(s) 73
HpyCH4V TGCA 1 cut(s) 197
HpyF10VI GCNNNNNNNGC 1 cut(s) 174
HpyF3I CTNAG 1 cut(s) 59
HpySE526I ACGT 1 cut(s) 73
Hsp92II CATG 1 cut(s) 310
LmnI GCTCC 1 cut(s) 128
LpnPI CCDG 7 cut(s) 99, 126, 150, 230, 284, 286, 309
MaeI CTAG 2 cut(s) 143, 331
MaeII ACGT 1 cut(s) 73
MaeIII GTNAC 3 cut(s) 54, 182, 262
MboII GAAGA 1 cut(s) 158
MhlI GDGCHC 1 cut(s) 125
MluCI AATT 1 cut(s) 41
MmeI TCCRAC 1 cut(s) 49
MnlI CCTC 4 cut(s) 58, 112, 142, 283
MseI TTAA 1 cut(s) 29
MspI CCGG 1 cut(s) 137
MspR9I CCNGG 2 cut(s) 114, 324
MvaI CCWGG 2 cut(s) 114, 324
MwoI GCNNNNNNNGC 1 cut(s) 174
NlaIII CATG 1 cut(s) 310
NlaIV GGNNCC 1 cut(s) 124
NmuCI GTSAC 1 cut(s) 262
PfeI GAWTC 1 cut(s) 319
PflMI CCANNNNNTGG 1 cut(s) 113
Psp6I CCWGG 2 cut(s) 112, 322
PspGI CCWGG 2 cut(s) 112, 322
PspN4I GGNNCC 1 cut(s) 124
PsrI GAACNNNNNNTAC 2 cut(s) 175, 207
RsaI GTAC 2 cut(s) 90, 329
RsaNI GTAC 2 cut(s) 89, 328
SaqAI TTAA 1 cut(s) 29
ScrFI CCNGG 2 cut(s) 114, 324
SduI GDGCHC 1 cut(s) 125
SetI ASST 7 cut(s) 35, 69, 76, 102, 153, 259, 294
Sse9I AATT 1 cut(s) 41
SspMI CTAG 2 cut(s) 143, 331
StyD4I CCNGG 2 cut(s) 112, 322
TaaI ACNGT 1 cut(s) 191
TaiI ACGT 1 cut(s) 76
TasI AATT 1 cut(s) 41
TfiI GAWTC 1 cut(s) 319
Tru1I TTAA 1 cut(s) 29
Tru9I TTAA 1 cut(s) 29
TseFI GTSAC 1 cut(s) 262
Tsp45I GTSAC 1 cut(s) 262
TspDTI ATGAA 1 cut(s) 258
Van91I CCANNNNNTGG 1 cut(s) 113
XspI CTAG 2 cut(s) 143, 331
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.