Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0007418.1

Orthogroup ID

OG0009388

Physical Location & Seq

Genomic Coordinates Forward (+)

34852 .. 37114

Gene Structure 2263 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0007418.1_g000010.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 480 bp

atgatggcctattgggccattgaaactgtgtaccaagatagctttgcccattgcctgggggagggctccaaaaccccaccggagctagaagaggtttgtcaaagatggggcaatgatggctttggtaactactgttctgctctccaaagcattgctctccaaagcattgctgactggcgtttgttgaaggccacagatgatgaggtgagtaaagcagaagtgacattcctgcgtgttcttgaatatgaggttgagttctggaacatgagccgtgggattcctgggtctccggtcaactcaggcgggtctccggccgacctccggcgaacttcctgggggtctcctgcgaacttccggcgggtctccggcacacctccagccaactttcggggaccacaaaagctactgtcactaacaccaaaagctactgtggctagcaacaaaagctactctgatgagattcccggacacctccggtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005829 GO:0044424 GO:0044444 GO:0044464

KEGG Pathways

Metabolic & Signaling

ko00730 ko01100 map00730 map01100

Pfam Domains

Protein Families

TENA_THI-4

Protein Analysis

159

Amino Acids

17.57

Weight (kDa)

5.7

Isoelectric Point (pI)

56.46

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009388)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G16990
fragaria_vesca	FvH4_4g19550
malus_domestica	MD16G1155500.v1.1
prunus_persica	Prupe.1G119400_v2.0.a1
pyrus_communis	pycom16g13180
rosa_chinensis	RchiOBHm_Chr4g0424801
rosa_laevigata	RLG00000007421 RLG00000007423 RLG00000007426
rosa_multiflora	Rmu_sc0003608.1_g000020 Rmu_sc0007418.1_g000003 Rmu_sc0007418.1_g000010
rosa_roxburghii	Rroxscaffold_5G00367020
rosa_rugosa	Rorug04G0199300
rosa_samantha	Rh4AG256900 Rh4BG262200 Rh4CG273200 Rh4DG257600 Rh4DG258000
rosa_wichuraiana	Rw4G022150 Rw4G022160 Rw4G024020

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	55
AciI	CCGC	2 cut(s)	303, 358
AcoI	YGGCCR	1 cut(s)	312
AfaI	GTAC	1 cut(s)	32
AfiI	CCNNNNNNNGG	4 cut(s)	55, 61, 321, 387
AgsI	TTSAA	3 cut(s)	23, 187, 242
AjnI	CCWGG	3 cut(s)	54, 280, 332
AluBI	AGCT	5 cut(s)	42, 85, 403, 425, 447
AluI	AGCT	5 cut(s)	42, 85, 403, 425, 447
Alw26I	GTCTC	4 cut(s)	291, 312, 345, 367
AoxI	GGCC	4 cut(s)	6, 15, 189, 312
AspS9I	GGNCC	2 cut(s)	15, 392
AsuC2I	CCSGG	1 cut(s)	465
AsuHPI	GGTGA	1 cut(s)	217
AsuNHI	GCTAGC	1 cut(s)	434
AvaII	GGWCC	1 cut(s)	392
BanII	GRGCYC	1 cut(s)	68
BccI	CCATC	2 cut(s)	99, 110
BceAI	ACGGC	1 cut(s)	255
BciT130I	CCWGG	3 cut(s)	56, 282, 334
BcnI	CCSGG	1 cut(s)	465
BcoDI	GTCTC	4 cut(s)	291, 312, 345, 367
BfaI	CTAG	2 cut(s)	86, 435
BglI	GCCNNNNNGGC	1 cut(s)	14
Bme1390I	CCNGG	4 cut(s)	56, 282, 334, 465
Bme18I	GGWCC	1 cut(s)	392
BmgT120I	GGNCC	2 cut(s)	15, 392
BmiI	GGNNCC	2 cut(s)	67, 393
BmrFI	CCNGG	4 cut(s)	56, 282, 334, 465
BmtI	GCTAGC	1 cut(s)	438
BpmI	CTGGAG	1 cut(s)	360
BpuMI	CCSGG	1 cut(s)	465
BsaI	GGTCTC	4 cut(s)	291, 312, 345, 367
BsaJI	CCNNGG	4 cut(s)	55, 271, 281, 333
BsaWI	WCCGGW	3 cut(s)	79, 289, 474
Bsc4I	CCNNNNNNNGG	4 cut(s)	55, 61, 321, 387
Bse1I	ACTGG	1 cut(s)	179
Bse3DI	GCAATG	4 cut(s)	49, 118, 150, 165
BseBI	CCWGG	3 cut(s)	56, 282, 334
BseDI	CCNNGG	4 cut(s)	55, 271, 281, 333
BseLI	CCNNNNNNNGG	4 cut(s)	55, 61, 321, 387
BseMI	GCAATG	4 cut(s)	49, 118, 150, 165
BseMII	CTCAG	1 cut(s)	312
BseNI	ACTGG	1 cut(s)	179
BseX3I	CGGCCG	1 cut(s)	312
Bsh1285I	CGRYCG	1 cut(s)	315
BshFI	GGCC	4 cut(s)	8, 17, 191, 314
BsiEI	CGRYCG	1 cut(s)	315
BsiSI	CCGG	8 cut(s)	80, 290, 311, 322, 355, 366, 465, 475
BslFI	GGGAC	1 cut(s)	405
BslI	CCNNNNNNNGG	4 cut(s)	55, 61, 321, 387
BsmAI	GTCTC	4 cut(s)	291, 312, 345, 367
BsmFI	GGGAC	1 cut(s)	405
BsnI	GGCC	4 cut(s)	8, 17, 191, 314
Bso31I	GGTCTC	4 cut(s)	291, 312, 345, 367
Bsp1286I	GDGCHC	1 cut(s)	68
BspACI	CCGC	2 cut(s)	303, 358
BspANI	GGCC	4 cut(s)	8, 17, 191, 314
BspCNI	CTCAG	1 cut(s)	311
BspLI	GGNNCC	2 cut(s)	67, 393
BspOI	GCTAGC	1 cut(s)	438
BspTNI	GGTCTC	4 cut(s)	291, 312, 345, 367
BsrDI	GCAATG	4 cut(s)	49, 118, 150, 165
BsrI	ACTGG	1 cut(s)	179
BssECI	CCNNGG	4 cut(s)	55, 271, 281, 333
Bst2UI	CCWGG	3 cut(s)	56, 282, 334
Bst4CI	ACNGT	4 cut(s)	28, 134, 408, 430
Bst6I	CTCTTC	1 cut(s)	84
BstC8I	GCNNGC	1 cut(s)	436
BstDEI	CTNAG	1 cut(s)	298
BstDSI	CCRYGG	1 cut(s)	271
BstENI	CCTNNNNNAGG	1 cut(s)	59
BstMAI	GTCTC	4 cut(s)	291, 312, 345, 367
BstMCI	CGRYCG	1 cut(s)	315
BstMWI	GCNNNNNNNGC	4 cut(s)	14, 117, 431, 444
BstNI	CCWGG	3 cut(s)	56, 282, 334
BstSCI	CCNGG	4 cut(s)	54, 280, 332, 463
BstZI	CGGCCG	1 cut(s)	312
BsuRI	GGCC	4 cut(s)	8, 17, 191, 314
BtgI	CCRYGG	1 cut(s)	271
Cac8I	GCNNGC	1 cut(s)	436
Cfr13I	GGNCC	2 cut(s)	15, 392
Csp6I	GTAC	1 cut(s)	31
CviAII	CATG	1 cut(s)	265
CviQI	GTAC	1 cut(s)	31
DdeI	CTNAG	1 cut(s)	298
EaeI	YGGCCR	1 cut(s)	312
EagI	CGGCCG	1 cut(s)	312
Eam1104I	CTCTTC	1 cut(s)	84
EarI	CTCTTC	1 cut(s)	84
EclXI	CGGCCG	1 cut(s)	312
Eco24I	GRGCYC	1 cut(s)	68
Eco31I	GGTCTC	4 cut(s)	291, 312, 345, 367
Eco47I	GGWCC	1 cut(s)	392
Eco52I	CGGCCG	1 cut(s)	312
EcoNI	CCTNNNNNAGG	1 cut(s)	59
EcoRII	CCWGG	3 cut(s)	54, 280, 332
EcoT38I	GRGCYC	1 cut(s)	68
FaeI	CATG	1 cut(s)	268
FaiI	YATR	2 cut(s)	246, 266
FaqI	GGGAC	1 cut(s)	405
FatI	CATG	1 cut(s)	264
FauI	CCCGC	2 cut(s)	296, 351
FriOI	GRGCYC	1 cut(s)	68
FspBI	CTAG	2 cut(s)	86, 435
GsuI	CTGGAG	1 cut(s)	360
HaeIII	GGCC	4 cut(s)	8, 17, 191, 314
HapII	CCGG	8 cut(s)	80, 290, 311, 322, 355, 366, 465, 475
Hin1II	CATG	1 cut(s)	268
HincII	GTYRAC	1 cut(s)	295
HindII	GTYRAC	1 cut(s)	295
HinfI	GANTC	2 cut(s)	277, 460
HpaII	CCGG	8 cut(s)	80, 290, 311, 322, 355, 366, 465, 475
HphI	GGTGA	1 cut(s)	217
Hpy166II	GTNNAC	2 cut(s)	31, 295
Hpy188I	TCNGA	1 cut(s)	454
Hpy188III	TCNNGA	2 cut(s)	239, 259
Hpy8I	GTNNAC	2 cut(s)	31, 295
HpyAV	CCTTC	1 cut(s)	181
HpyCH4III	ACNGT	4 cut(s)	28, 134, 408, 430
HpyF10VI	GCNNNNNNNGC	4 cut(s)	14, 117, 431, 444
HpyF3I	CTNAG	1 cut(s)	298
Hsp92II	CATG	1 cut(s)	268
LmnI	GCTCC	2 cut(s)	71, 82
MaeI	CTAG	2 cut(s)	86, 435
MaeIII	GTNAC	3 cut(s)	125, 220, 408
MboII	GAAGA	1 cut(s)	101
MhlI	GDGCHC	1 cut(s)	68
MnlI	CCTC	6 cut(s)	55, 85, 196, 241, 329, 384
MspI	CCGG	8 cut(s)	80, 290, 311, 322, 355, 366, 465, 475
MspR9I	CCNGG	4 cut(s)	56, 282, 334, 465
MvaI	CCWGG	3 cut(s)	56, 282, 334
MwoI	GCNNNNNNNGC	4 cut(s)	14, 117, 431, 444
NciI	CCSGG	1 cut(s)	465
NheI	GCTAGC	1 cut(s)	434
NlaIII	CATG	1 cut(s)	268
NlaIV	GGNNCC	2 cut(s)	67, 393
NmuCI	GTSAC	2 cut(s)	220, 408
PfeI	GAWTC	2 cut(s)	277, 460
PflMI	CCANNNNNTGG	1 cut(s)	55
PfoI	TCCNGGA	1 cut(s)	463
Psp6I	CCWGG	3 cut(s)	54, 280, 332
PspGI	CCWGG	3 cut(s)	54, 280, 332
PspN4I	GGNNCC	2 cut(s)	67, 393
PspPI	GGNCC	2 cut(s)	15, 392
PsrI	GAACNNNNNNTAC	2 cut(s)	118, 150
RsaI	GTAC	1 cut(s)	32
RsaNI	GTAC	1 cut(s)	31
Sau96I	GGNCC	2 cut(s)	15, 392
ScrFI	CCNGG	4 cut(s)	56, 282, 334, 465
SduI	GDGCHC	1 cut(s)	68
SfiI	GGCCNNNNNGGCC	1 cut(s)	14
SinI	GGWCC	1 cut(s)	392
SsiI	CCGC	2 cut(s)	303, 358
SspMI	CTAG	2 cut(s)	86, 435
StyD4I	CCNGG	4 cut(s)	54, 280, 332, 463
TaaI	ACNGT	4 cut(s)	28, 134, 408, 430
TfiI	GAWTC	2 cut(s)	277, 460
TseFI	GTSAC	2 cut(s)	220, 408
Tsp45I	GTSAC	2 cut(s)	220, 408
Van91I	CCANNNNNTGG	1 cut(s)	55
VpaK11BI	GGWCC	1 cut(s)	392
XagI	CCTNNNNNAGG	1 cut(s)	59
XspI	CTAG	2 cut(s)	86, 435

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.