RLG00000010838

DNA topoisomerase

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr3
Physical Location & Seq
Reverse (-)
4701327 .. 4703507
2181 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000010838

Sequence Viewer

Length: 444 bp
ATGCTGGTGAGTTCATTGTTTTCCAATTTGCGTGCTCAAGGGTTCAGTTCCTTGGGTATCAGGCAGTTTTTCAGGATGTGGAAGCTGGAGCAGTCAAATATTAAGAAAATGAAGGGGATCAATCGGGATGAAGCTTTTGCACTTCTTGATTCACTGAACGCAACTGCAAAGCAGTGTCCGGTACATCTTGCTGAAGTGGAACTCAAGCAATTCCAAACCCAACCTCCTCCACGCTACTCTGAGGCATTATTGGTTAAGAAATTAGAGGTGCTTGGGATTGGAAGTGCTTCGACATATGCAAGCACTATAAAGGATAGAAACTATTTGACAGTGAAAAGCTGTGTGTTACATCCAGAGTTTCTTGGTCGTATGGTGTCAGCATTTCTCTGCCACCATTTTTCTGAGGTCACAGCTTATAGCTTCACTGCTGGACATTGTGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

148

Amino Acids

16.49

Weight (kDa)

9.3

Isoelectric Point (pI)

35.27

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Topoisom_bac PF01131 45 - 143 1.8e-17 DNA topoisomerase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 125
AcuI CTGAAG 1 cut(s) 213
AfaI GTAC 1 cut(s) 183
AluBI AGCT 5 cut(s) 85, 134, 339, 413, 420
AluI AGCT 5 cut(s) 85, 134, 339, 413, 420
Alw21I GWGCWC 1 cut(s) 37
AlwI GGATC 1 cut(s) 125
Asp700I GAANNNNTTC 1 cut(s) 286
AsuHPI GGTGA 1 cut(s) 19
Bbv12I GWGCWC 1 cut(s) 37
BpmI CTGGAG 1 cut(s) 107
BpuEI CTTGAG 2 cut(s) 21, 188
BsaJI CCNNGG 1 cut(s) 51
BsaWI WCCGGW 1 cut(s) 178
BsaXI ACNNNNNCTCC 2 cut(s) 208, 238
BseDI CCNNGG 1 cut(s) 51
BseGI GGATG 3 cut(s) 81, 133, 349
BseMII CTCAG 2 cut(s) 231, 393
BseRI GAGGAG 1 cut(s) 216
BsiHKAI GWGCWC 1 cut(s) 37
BsiSI CCGG 1 cut(s) 179
Bsp1286I GDGCHC 1 cut(s) 37
Bsp143I GATC 1 cut(s) 117
BspCNI CTCAG 2 cut(s) 232, 394
BspPI GGATC 1 cut(s) 125
BssECI CCNNGG 1 cut(s) 51
BssMI GATC 1 cut(s) 117
BssT1I CCWWGG 1 cut(s) 51
Bst4CI ACNGT 1 cut(s) 331
BstC8I GCNNGC 2 cut(s) 33, 301
BstDEI CTNAG 2 cut(s) 240, 402
BstF5I GGATG 3 cut(s) 81, 133, 349
BstKTI GATC 1 cut(s) 120
BstMBI GATC 1 cut(s) 117
BtsCI GGATG 3 cut(s) 81, 133, 349
BtsI GCAGTG 2 cut(s) 179, 423
BtsIMutI CAGTG 4 cut(s) 152, 179, 336, 423
Cac8I GCNNGC 2 cut(s) 33, 301
Csp6I GTAC 1 cut(s) 182
CviJI RGCY 5 cut(s) 85, 134, 339, 413, 420
CviKI_1 RGCY 5 cut(s) 85, 134, 339, 413, 420
CviQI GTAC 1 cut(s) 182
DdeI CTNAG 2 cut(s) 240, 402
DpnI GATC 1 cut(s) 119
DpnII GATC 1 cut(s) 117
Eco130I CCWWGG 1 cut(s) 51
Eco57I CTGAAG 1 cut(s) 213
EcoT14I CCWWGG 1 cut(s) 51
ErhI CCWWGG 1 cut(s) 51
FaiI YATR 5 cut(s) 295, 297, 308, 371, 417
FauNDI CATATG 1 cut(s) 295
FokI GGATG 3 cut(s) 88, 140, 336
GsuI CTGGAG 1 cut(s) 107
HapII CCGG 1 cut(s) 179
HindIII AAGCTT 1 cut(s) 132
HinfI GANTC 1 cut(s) 149
HpaII CCGG 1 cut(s) 179
HphI GGTGA 1 cut(s) 19
Hpy188I TCNGA 2 cut(s) 241, 403
Hpy188III TCNNGA 4 cut(s) 73, 125, 146, 353
HpyAV CCTTC 1 cut(s) 106
HpyCH4III ACNGT 1 cut(s) 331
HpyCH4V TGCA 3 cut(s) 140, 167, 299
HpyF3I CTNAG 2 cut(s) 240, 402
Kzo9I GATC 1 cut(s) 117
LmnI GCTCC 1 cut(s) 88
LpnPI CCDG 6 cut(s) 46, 58, 71, 192, 366, 414
MaeIII GTNAC 2 cut(s) 345, 406
MalI GATC 1 cut(s) 119
MboI GATC 1 cut(s) 117
MhlI GDGCHC 1 cut(s) 37
MluCI AATT 3 cut(s) 25, 209, 260
MnlI CCTC 5 cut(s) 234, 235, 237, 259, 397
MroXI GAANNNNTTC 1 cut(s) 286
MseI TTAA 2 cut(s) 102, 255
MspI CCGG 1 cut(s) 179
NdeI CATATG 1 cut(s) 295
NdeII GATC 1 cut(s) 117
NmuCI GTSAC 1 cut(s) 406
PdmI GAANNNNTTC 1 cut(s) 286
PfeI GAWTC 1 cut(s) 149
RsaI GTAC 1 cut(s) 183
RsaNI GTAC 1 cut(s) 182
SaqAI TTAA 2 cut(s) 102, 255
Sau3AI GATC 1 cut(s) 117
SduI GDGCHC 1 cut(s) 37
SetI ASST 8 cut(s) 87, 136, 226, 270, 341, 408, 415, 422
SmlI CTYRAG 2 cut(s) 36, 203
SmoI CTYRAG 2 cut(s) 36, 203
Sse9I AATT 3 cut(s) 25, 209, 260
SspI AATATT 1 cut(s) 100
StyI CCWWGG 1 cut(s) 51
TaaI ACNGT 1 cut(s) 331
TaqI TCGA 1 cut(s) 290
TasI AATT 3 cut(s) 25, 209, 260
TfiI GAWTC 1 cut(s) 149
Tru1I TTAA 2 cut(s) 102, 255
Tru9I TTAA 2 cut(s) 102, 255
TscAI CASTG 4 cut(s) 159, 179, 336, 430
TseFI GTSAC 1 cut(s) 406
Tsp45I GTSAC 1 cut(s) 406
TspDTI ATGAA 2 cut(s) 125, 144
TspRI CASTG 4 cut(s) 159, 179, 336, 430
XmnI GAANNNNTTC 1 cut(s) 286
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.