RLG00000024288

Auxin responsive protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr5
OG0005742
Physical Location & Seq
Forward (+)
34120550 .. 34120915
366 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000024288

Sequence Viewer

Length: 366 bp
ATGAAGCTCAGGCTCATAATCGAGAAGCTACAAAAGGGCCTCTCGCTCTTAGTAACCAAAGGCCCTCACGATGATCAGCACGATGAATTCGATGAAGACTTGGACGTAGCGAAGATGGTACCCGAGGATGTAAAGGAAGGACATTTTGCAGTGTTTGCAGTGAAGGGTAAGGAGCCAAAGAGGTTTGTGATTAAGCTAGAGTCCTTGAATAACCCTGCATTTTTGAAATTACTAGAGCAGGCCAAGGAAGAATATGGTTTTCAACAGAAAGGTGCTCTTGAAGTTCCATGCAGACCTGAGGATTTGCATAAGATTCTGGAGAACAGGAGGGAGAAGAGTAGGACTAGTGCTACATGTACCTTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04075 map04075
Pfam Domains
Protein Families
Auxin_inducible

Protein Analysis

122

Amino Acids

13.88

Weight (kDa)

6.43

Isoelectric Point (pI)

47.17

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Auxin_inducible PF02519 39 - 106 4.3e-17 Auxin responsive protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 118
AccB1I GGYRCC 1 cut(s) 118
AcsI RAATTY 1 cut(s) 86
AfaI GTAC 2 cut(s) 120, 358
AflIII ACRYGT 1 cut(s) 353
AgsI TTSAA 4 cut(s) 208, 226, 263, 281
AhlI ACTAGT 1 cut(s) 344
AluBI AGCT 3 cut(s) 7, 28, 196
AluI AGCT 3 cut(s) 7, 28, 196
Alw21I GWGCWC 1 cut(s) 277
Ama87I CYCGRG 1 cut(s) 122
AoxI GGCC 3 cut(s) 37, 61, 240
ApoI RAATTY 1 cut(s) 86
Asp718I GGTACC 1 cut(s) 118
AspS9I GGNCC 2 cut(s) 37, 62
AvaI CYCGRG 1 cut(s) 122
AxyI CCTNAGG 1 cut(s) 297
BanI GGYRCC 1 cut(s) 118
BbsI GAAGAC 1 cut(s) 102
Bbv12I GWGCWC 1 cut(s) 277
BccI CCATC 1 cut(s) 109
BclI TGATCA 1 cut(s) 73
BcuI ACTAGT 1 cut(s) 344
BfaI CTAG 3 cut(s) 197, 233, 345
BmeT110I CYCGRG 1 cut(s) 122
BmgT120I GGNCC 2 cut(s) 37, 62
BmiI GGNNCC 2 cut(s) 120, 174
BpiI GAAGAC 1 cut(s) 102
BpmI CTGGAG 1 cut(s) 338
Bpu10I CCTNAGC 1 cut(s) 8
BsaJI CCNNGG 2 cut(s) 123, 243
Bse21I CCTNAGG 1 cut(s) 297
BseDI CCNNGG 2 cut(s) 123, 243
BseGI GGATG 1 cut(s) 133
BseMII CTCAG 2 cut(s) 22, 288
BshFI GGCC 3 cut(s) 39, 63, 242
BshNI GGYRCC 1 cut(s) 118
BsiHKAI GWGCWC 1 cut(s) 277
BsiHKCI CYCGRG 1 cut(s) 122
BsnI GGCC 3 cut(s) 39, 63, 242
BsoBI CYCGRG 1 cut(s) 122
Bsp1286I GDGCHC 1 cut(s) 277
Bsp143I GATC 1 cut(s) 73
BspANI GGCC 3 cut(s) 39, 63, 242
BspCNI CTCAG 2 cut(s) 21, 289
BspLI GGNNCC 2 cut(s) 120, 174
BspT107I GGYRCC 1 cut(s) 118
BssECI CCNNGG 2 cut(s) 123, 243
BssMI GATC 1 cut(s) 73
BssT1I CCWWGG 1 cut(s) 243
Bst6I CTCTTC 1 cut(s) 329
BstAPI GCANNNNNTGC 1 cut(s) 155
BstC8I GCNNGC 1 cut(s) 240
BstDEI CTNAG 3 cut(s) 8, 49, 297
BstF5I GGATG 1 cut(s) 133
BstKTI GATC 1 cut(s) 76
BstMBI GATC 1 cut(s) 73
BstMWI GCNNNNNNNGC 1 cut(s) 155
BstNSI RCATGY 1 cut(s) 357
BstV2I GAAGAC 1 cut(s) 102
Bsu36I CCTNAGG 1 cut(s) 297
BsuRI GGCC 3 cut(s) 39, 63, 242
BtsCI GGATG 1 cut(s) 133
BtsI GCAGTG 2 cut(s) 156, 165
BtsIMutI CAGTG 2 cut(s) 156, 165
Cac8I GCNNGC 1 cut(s) 240
Cfr13I GGNCC 2 cut(s) 37, 62
Csp6I GTAC 2 cut(s) 119, 357
CviAII CATG 2 cut(s) 288, 354
CviJI RGCY 8 cut(s) 7, 13, 28, 39, 63, 175, 196, 242
CviKI_1 RGCY 8 cut(s) 7, 13, 28, 39, 63, 175, 196, 242
CviQI GTAC 2 cut(s) 119, 357
DdeI CTNAG 3 cut(s) 8, 49, 297
DpnI GATC 1 cut(s) 75
DpnII GATC 1 cut(s) 73
Eam1104I CTCTTC 1 cut(s) 329
EarI CTCTTC 1 cut(s) 329
Eco130I CCWWGG 1 cut(s) 243
Eco81I CCTNAGG 1 cut(s) 297
Eco88I CYCGRG 1 cut(s) 122
EcoO109I RGGNCCY 2 cut(s) 37, 62
EcoRI GAATTC 1 cut(s) 86
EcoT14I CCWWGG 1 cut(s) 243
ErhI CCWWGG 1 cut(s) 243
FaeI CATG 2 cut(s) 291, 357
FaiI YATR 6 cut(s) 17, 255, 289, 309, 355, 364
FalI AAGNNNNNCTT 2 cut(s) 261, 293
FatI CATG 2 cut(s) 287, 353
FbaI TGATCA 1 cut(s) 73
FokI GGATG 1 cut(s) 140
FspBI CTAG 3 cut(s) 197, 233, 345
GsuI CTGGAG 1 cut(s) 338
HaeIII GGCC 3 cut(s) 39, 63, 242
Hin1II CATG 2 cut(s) 291, 357
HinfI GANTC 2 cut(s) 200, 313
Hpy188III TCNNGA 4 cut(s) 22, 68, 278, 317
HpyAV CCTTC 2 cut(s) 131, 157
HpyCH4IV ACGT 1 cut(s) 105
HpyCH4V TGCA 5 cut(s) 149, 158, 218, 291, 307
HpyF10VI GCNNNNNNNGC 1 cut(s) 155
HpyF3I CTNAG 3 cut(s) 8, 49, 297
HpySE526I ACGT 1 cut(s) 105
Hsp92II CATG 2 cut(s) 291, 357
KpnI GGTACC 1 cut(s) 122
Ksp22I TGATCA 1 cut(s) 73
Kzo9I GATC 1 cut(s) 73
LmnI GCTCC 1 cut(s) 172
LpnPI CCDG 5 cut(s) 224, 228, 302, 309, 310
MaeI CTAG 3 cut(s) 197, 233, 345
MaeII ACGT 1 cut(s) 105
MaeIII GTNAC 1 cut(s) 52
MalI GATC 1 cut(s) 75
MboI GATC 1 cut(s) 73
MboII GAAGA 4 cut(s) 107, 124, 260, 346
MhlI GDGCHC 1 cut(s) 277
MluCI AATT 2 cut(s) 86, 227
MlyI GAGTC 1 cut(s) 209
MnlI CCTC 6 cut(s) 50, 75, 118, 174, 292, 321
MseI TTAA 1 cut(s) 192
MwoI GCNNNNNNNGC 1 cut(s) 155
NdeII GATC 1 cut(s) 73
NlaIII CATG 2 cut(s) 291, 357
NlaIV GGNNCC 2 cut(s) 120, 174
NspI RCATGY 1 cut(s) 357
PciI ACATGT 1 cut(s) 353
PcsI WCGNNNNNNNCGW 1 cut(s) 87
PfeI GAWTC 1 cut(s) 313
PleI GAGTC 1 cut(s) 208
PpsI GAGTC 1 cut(s) 208
PscI ACATGT 1 cut(s) 353
PspN4I GGNNCC 2 cut(s) 120, 174
PspPI GGNCC 2 cut(s) 37, 62
RsaI GTAC 2 cut(s) 120, 358
RsaNI GTAC 2 cut(s) 119, 357
SaqAI TTAA 1 cut(s) 192
Sau3AI GATC 1 cut(s) 73
Sau96I GGNCC 2 cut(s) 37, 62
SchI GAGTC 1 cut(s) 209
SduI GDGCHC 1 cut(s) 277
SetI ASST 8 cut(s) 9, 30, 108, 185, 198, 274, 298, 362
SpeI ACTAGT 1 cut(s) 344
Sse9I AATT 2 cut(s) 86, 227
SspMI CTAG 3 cut(s) 197, 233, 345
StyI CCWWGG 1 cut(s) 243
TaiI ACGT 1 cut(s) 108
TaqI TCGA 2 cut(s) 21, 90
TasI AATT 2 cut(s) 86, 227
TfiI GAWTC 1 cut(s) 313
Tru1I TTAA 1 cut(s) 192
Tru9I TTAA 1 cut(s) 192
TscAI CASTG 2 cut(s) 156, 165
TspDTI ATGAA 3 cut(s) 17, 99, 108
TspRI CASTG 2 cut(s) 156, 165
XapI RAATTY 1 cut(s) 86
XceI RCATGY 1 cut(s) 357
XspI CTAG 3 cut(s) 197, 233, 345
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.