RLG00000029638

No description available

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr6
Physical Location & Seq
Forward (+)
41793472 .. 41820963
27492 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000029638

Sequence Viewer

Length: 387 bp
ATGGCGAAATTGAGCTTGGGTGACCAATCTTTCTTTCTCATGGCCTTCATCGCCTGCACGACTTCAGTGGCATTTACGAGCCTTGTAATTGCAGCTGTCCCGACATGTGCAATGGGGAGTGCTGCAACATCTCTTTCAAAGCTAGTAGATACAGCTCATCAAGAACGCCCTAGTACTATGGCTGCCATTAGGCTCTTAGGAATGGAAATAAGTGATCTCACACTGGAACTGAATGACCTAAGAAAGTGGTACAAATTTATTGAGGGGGACAAAACCAAGACCCCAATAAGAAGAAGCCGAAATACAAAACAGCCAAACTTAAAAAGCTACAAGCTGCTACAATCTAAAAAAATTGAGTTCGAATATTATTTAGTCGTTGGGTTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

129

Amino Acids

14.29

Weight (kDa)

9.48

Isoelectric Point (pI)

50.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 254
AcuI CTGAAG 1 cut(s) 48
AfaI GTAC 2 cut(s) 175, 251
AflIII ACRYGT 1 cut(s) 104
AgsI TTSAA 1 cut(s) 138
AjuI GAANNNNNNNTTGG 3 cut(s) 18, 31, 50
AluBI AGCT 6 cut(s) 15, 95, 142, 155, 327, 334
AluI AGCT 6 cut(s) 15, 95, 142, 155, 327, 334
AoxI GGCC 1 cut(s) 42
ApeKI GCWGC 4 cut(s) 92, 122, 182, 334
ApoI RAATTY 1 cut(s) 254
AsuHPI GGTGA 1 cut(s) 32
AsuII TTCGAA 1 cut(s) 360
BarI GAAGNNNNNNTAC 2 cut(s) 286, 318
BbvI GCAGC 4 cut(s) 104, 109, 169, 321
BfaI CTAG 2 cut(s) 143, 171
BisI GCNGC 4 cut(s) 93, 123, 183, 335
BlsI GCNGC 4 cut(s) 94, 124, 184, 336
BmcAI AGTACT 1 cut(s) 175
Bpu14I TTCGAA 1 cut(s) 360
Bse1I ACTGG 1 cut(s) 228
Bse3DI GCAATG 1 cut(s) 117
BseMI GCAATG 1 cut(s) 117
BseNI ACTGG 1 cut(s) 228
BseXI GCAGC 4 cut(s) 104, 109, 169, 321
BsgI GTGCAG 1 cut(s) 40
BshFI GGCC 1 cut(s) 44
BslFI GGGAC 2 cut(s) 83, 281
BsmFI GGGAC 2 cut(s) 83, 281
BsnI GGCC 1 cut(s) 44
Bsp119I TTCGAA 1 cut(s) 360
Bsp143I GATC 1 cut(s) 214
BspANI GGCC 1 cut(s) 44
BspT104I TTCGAA 1 cut(s) 360
BsrDI GCAATG 1 cut(s) 117
BsrI ACTGG 1 cut(s) 228
BssMI GATC 1 cut(s) 214
BstBI TTCGAA 1 cut(s) 360
BstC8I GCNNGC 1 cut(s) 55
BstDEI CTNAG 2 cut(s) 196, 239
BstEII GGTNACC 1 cut(s) 20
BstKTI GATC 1 cut(s) 217
BstMBI GATC 1 cut(s) 214
BstMWI GCNNNNNNNGC 1 cut(s) 50
BstNSI RCATGY 1 cut(s) 108
BstPI GGTNACC 1 cut(s) 20
BstV1I GCAGC 4 cut(s) 104, 109, 169, 321
BsuRI GGCC 1 cut(s) 44
BtgZI GCGATG 1 cut(s) 34
BtsIMutI CAGTG 2 cut(s) 72, 221
Cac8I GCNNGC 1 cut(s) 55
Csp6I GTAC 2 cut(s) 174, 250
CviAII CATG 2 cut(s) 40, 105
CviQI GTAC 2 cut(s) 174, 250
DdeI CTNAG 2 cut(s) 196, 239
DpnI GATC 1 cut(s) 216
DpnII GATC 1 cut(s) 214
Eco57I CTGAAG 1 cut(s) 48
Eco91I GGTNACC 1 cut(s) 20
EcoO65I GGTNACC 1 cut(s) 20
FaeI CATG 2 cut(s) 43, 108
FaiI YATR 4 cut(s) 41, 106, 179, 385
FaqI GGGAC 2 cut(s) 83, 281
FatI CATG 2 cut(s) 39, 104
Fnu4HI GCNGC 4 cut(s) 93, 123, 183, 335
Fsp4HI GCNGC 4 cut(s) 93, 123, 183, 335
FspBI CTAG 2 cut(s) 143, 171
GluI GCNGC 4 cut(s) 93, 123, 183, 335
HaeIII GGCC 1 cut(s) 44
Hin1II CATG 2 cut(s) 43, 108
HphI GGTGA 1 cut(s) 32
Hpy188III TCNNGA 2 cut(s) 100, 161
HpyAV CCTTC 1 cut(s) 55
HpyCH4V TGCA 4 cut(s) 57, 92, 110, 125
HpyF10VI GCNNNNNNNGC 1 cut(s) 50
HpyF3I CTNAG 2 cut(s) 196, 239
Hsp92II CATG 2 cut(s) 43, 108
Kzo9I GATC 1 cut(s) 214
LpnPI CCDG 2 cut(s) 67, 209
Lsp1109I GCAGC 4 cut(s) 104, 109, 169, 321
MaeI CTAG 2 cut(s) 143, 171
MaeIII GTNAC 1 cut(s) 20
MalI GATC 1 cut(s) 216
MboI GATC 1 cut(s) 214
MboII GAAGA 1 cut(s) 303
MluCI AATT 4 cut(s) 8, 87, 254, 351
MnlI CCTC 1 cut(s) 256
MseI TTAA 1 cut(s) 320
MspA1I CMGCKG 1 cut(s) 95
MwoI GCNNNNNNNGC 1 cut(s) 50
NdeII GATC 1 cut(s) 214
NlaIII CATG 2 cut(s) 43, 108
NmuCI GTSAC 1 cut(s) 20
NspI RCATGY 1 cut(s) 108
NspV TTCGAA 1 cut(s) 360
PciI ACATGT 1 cut(s) 104
PkrI GCNGC 4 cut(s) 94, 124, 184, 336
PscI ACATGT 1 cut(s) 104
PspEI GGTNACC 1 cut(s) 20
PvuII CAGCTG 1 cut(s) 95
RsaI GTAC 2 cut(s) 175, 251
RsaNI GTAC 2 cut(s) 174, 250
SaqAI TTAA 1 cut(s) 320
SatI GCNGC 4 cut(s) 93, 123, 183, 335
Sau3AI GATC 1 cut(s) 214
ScaI AGTACT 1 cut(s) 175
SetI ASST 7 cut(s) 17, 97, 144, 157, 240, 329, 336
SfuI TTCGAA 1 cut(s) 360
Sse9I AATT 4 cut(s) 8, 87, 254, 351
SspI AATATT 1 cut(s) 365
SspMI CTAG 2 cut(s) 143, 171
TaqI TCGA 1 cut(s) 360
TasI AATT 4 cut(s) 8, 87, 254, 351
TatI WGTACW 1 cut(s) 173
Tru1I TTAA 1 cut(s) 320
Tru9I TTAA 1 cut(s) 320
TscAI CASTG 2 cut(s) 72, 228
TseFI GTSAC 1 cut(s) 20
TseI GCWGC 4 cut(s) 92, 122, 182, 334
Tsp45I GTSAC 1 cut(s) 20
TspDTI ATGAA 1 cut(s) 37
TspRI CASTG 2 cut(s) 72, 228
XapI RAATTY 1 cut(s) 254
XceI RCATGY 1 cut(s) 108
XspI CTAG 2 cut(s) 143, 171
ZrmI AGTACT 1 cut(s) 175
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.