Rmu_sc0001038.1_g000008

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001038.1
Physical Location & Seq
Forward (+)
39228 .. 41895
2668 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001038.1_g000008.1.cds

Sequence Viewer

Length: 807 bp
atgaaatctttacacctctccgctcaatttcgtgccctcaatcccaatcacacttcttcttcttcgatcactctcctccgaccctgcaaattcaactctctttccctcgcctcgcctcccaagccctcccgcttaatcacgctttgcgcttccaattcagacaaaccgtcgtcggaatcggcggcggtggggtccatcagggaagggtttcttcagtttcagaacgacccgtcgcagagtcagtggaatgtggaagtcggaagccctaacgttccgggtccgtccgtggcgaaattgagcttgggcgaccaggctttctttctcatggccttcatcgcctgcacgacttcggtggcatttacgagccttgtaattgcagctgtcccgacgatatgtgcaatggggagagctgcaacatctctttcaaagctggcagatacagctcgtcaagaactccctagtactatggctgccattaggctctcaggcatggaaataagtgatctcacactggaactgaatgacctaagccaagagatagctgatggggtcaacaaatccactcaagctgttcaagcagcagaagctgggattcggcagattggctcactcgctcggcagcaaacaatgtcaatgattcaagagagggcaaacctgccagtaatctctttgcaacctgccgtaattggagcagcaaagaagacctctcatgctgttggccaagtgactaagaagttcatgaatataatctctcaaagggactcagaggatgaggatgacattggaattgatagggtggaaatttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

268

Amino Acids

28.47

Weight (kDa)

6.31

Isoelectric Point (pI)

47.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 2 cut(s) 663, 685
AccBSI CCGCTC 1 cut(s) 23
AciI CCGC 4 cut(s) 21, 130, 182, 185
AclI AACGTT 1 cut(s) 270
AcoI YGGCCR 1 cut(s) 718
AcsI RAATTY 2 cut(s) 89, 801
AcuI CTGAAG 1 cut(s) 197
AfaI GTAC 1 cut(s) 463
AgsI TTSAA 4 cut(s) 94, 426, 575, 641
AhdI GACNNNNNGTC 1 cut(s) 166
AjnI CCWGG 1 cut(s) 309
AjuI GAANNNNNNNTTGG 2 cut(s) 284, 316
AluBI AGCT 8 cut(s) 300, 380, 410, 430, 443, 542, 569, 587
AluI AGCT 8 cut(s) 300, 380, 410, 430, 443, 542, 569, 587
AlwNI CAGNNNCTG 1 cut(s) 587
AoxI GGCC 2 cut(s) 327, 718
ApeKI GCWGC 6 cut(s) 377, 410, 470, 578, 619, 692
ApoI RAATTY 2 cut(s) 89, 801
Asp700I GAANNNNTTC 1 cut(s) 207
AspLEI GCGC 1 cut(s) 149
AspS9I GGNCC 2 cut(s) 192, 278
AsuC2I CCSGG 1 cut(s) 276
AvaII GGWCC 2 cut(s) 192, 278
BaeGI GKGCMC 1 cut(s) 37
BalI TGGCCA 1 cut(s) 720
BbsI GAAGAC 1 cut(s) 707
BbvI GCAGC 6 cut(s) 389, 397, 457, 590, 631, 704
BccI CCATC 2 cut(s) 203, 539
BceAI ACGGC 1 cut(s) 665
BciT130I CCWGG 1 cut(s) 311
BcnI CCSGG 1 cut(s) 276
BfaI CTAG 1 cut(s) 459
BfuAI ACCTGC 2 cut(s) 663, 685
BisI GCNGC 7 cut(s) 183, 378, 411, 471, 579, 620, 693
BlsI GCNGC 7 cut(s) 184, 379, 412, 472, 580, 621, 694
BmcAI AGTACT 1 cut(s) 463
Bme1390I CCNGG 2 cut(s) 276, 311
Bme18I GGWCC 2 cut(s) 192, 278
BmeRI GACNNNNNGTC 1 cut(s) 166
BmgT120I GGNCC 2 cut(s) 192, 278
BmiI GGNNCC 2 cut(s) 193, 279
BmrFI CCNGG 2 cut(s) 276, 311
BpiI GAAGAC 1 cut(s) 707
Bpu10I CCTNAGC 1 cut(s) 527
BpuEI CTTGAG 1 cut(s) 549
BpuMI CCSGG 1 cut(s) 276
BsaJI CCNNGG 1 cut(s) 285
Bse1I ACTGG 2 cut(s) 516, 659
Bse3DI GCAATG 1 cut(s) 405
BseBI CCWGG 1 cut(s) 311
BseDI CCNNGG 1 cut(s) 285
BseGI GGATG 2 cut(s) 775, 781
BseMI GCAATG 1 cut(s) 405
BseMII CTCAG 2 cut(s) 498, 777
BseNI ACTGG 2 cut(s) 516, 659
BseRI GAGGAG 1 cut(s) 65
BseSI GKGCMC 1 cut(s) 37
BseXI GCAGC 6 cut(s) 389, 397, 457, 590, 631, 704
BseYI CCCAGC 1 cut(s) 587
BsgI GTGCAG 1 cut(s) 325
BshFI GGCC 2 cut(s) 329, 720
BsiSI CCGG 1 cut(s) 275
BslFI GGGAC 2 cut(s) 368, 773
BsmFI GGGAC 2 cut(s) 368, 773
BsnI GGCC 2 cut(s) 329, 720
Bsp1286I GDGCHC 1 cut(s) 37
Bsp143I GATC 2 cut(s) 66, 502
BspACI CCGC 4 cut(s) 21, 130, 182, 185
BspANI GGCC 2 cut(s) 329, 720
BspCNI CTCAG 2 cut(s) 497, 776
BspHI TCATGA 1 cut(s) 738
BspLI GGNNCC 2 cut(s) 193, 279
BspMI ACCTGC 2 cut(s) 663, 685
BsrBI CCGCTC 1 cut(s) 23
BsrDI GCAATG 1 cut(s) 405
BsrI ACTGG 2 cut(s) 516, 659
BssECI CCNNGG 1 cut(s) 285
BssMI GATC 2 cut(s) 66, 502
Bst2UI CCWGG 1 cut(s) 311
Bst4CI ACNGT 1 cut(s) 168
BstC8I GCNNGC 2 cut(s) 340, 432
BstDEI CTNAG 4 cut(s) 484, 527, 729, 763
BstDSI CCRYGG 1 cut(s) 285
BstF5I GGATG 2 cut(s) 775, 781
BstHHI GCGC 1 cut(s) 149
BstKTI GATC 2 cut(s) 69, 505
BstMBI GATC 2 cut(s) 66, 502
BstMWI GCNNNNNNNGC 5 cut(s) 121, 335, 440, 575, 584
BstNI CCWGG 1 cut(s) 311
BstSCI CCNGG 2 cut(s) 274, 309
BstSLI GKGCMC 1 cut(s) 37
BstV1I GCAGC 6 cut(s) 389, 397, 457, 590, 631, 704
BstV2I GAAGAC 1 cut(s) 707
BsuRI GGCC 2 cut(s) 329, 720
BtgI CCRYGG 1 cut(s) 285
BtgZI GCGATG 1 cut(s) 319
BtsCI GGATG 2 cut(s) 775, 781
BtsIMutI CAGTG 2 cut(s) 248, 509
BveI ACCTGC 2 cut(s) 663, 685
Cac8I GCNNGC 2 cut(s) 340, 432
CaiI CAGNNNCTG 1 cut(s) 587
CciI TCATGA 1 cut(s) 738
CfoI GCGC 1 cut(s) 149
Cfr13I GGNCC 2 cut(s) 192, 278
Csp6I GTAC 1 cut(s) 462
CviAII CATG 4 cut(s) 325, 490, 710, 739
CviQI GTAC 1 cut(s) 462
DdeI CTNAG 4 cut(s) 484, 527, 729, 763
DpnI GATC 2 cut(s) 68, 504
DpnII GATC 2 cut(s) 66, 502
DriI GACNNNNNGTC 1 cut(s) 166
EaeI YGGCCR 1 cut(s) 718
Eam1105I GACNNNNNGTC 1 cut(s) 166
Eco47I GGWCC 2 cut(s) 192, 278
Eco57I CTGAAG 1 cut(s) 197
EcoRII CCWGG 1 cut(s) 309
FaeI CATG 4 cut(s) 328, 493, 713, 742
FaiI YATR 7 cut(s) 326, 394, 467, 491, 711, 740, 746
FalI AAGNNNNNCTT 2 cut(s) 195, 227
FaqI GGGAC 2 cut(s) 368, 773
FatI CATG 4 cut(s) 324, 489, 709, 738
FauI CCCGC 1 cut(s) 137
Fnu4HI GCNGC 7 cut(s) 183, 378, 411, 471, 579, 620, 693
FokI GGATG 2 cut(s) 782, 788
Fsp4HI GCNGC 7 cut(s) 183, 378, 411, 471, 579, 620, 693
FspBI CTAG 1 cut(s) 459
GlaI GCGC 1 cut(s) 148
GluI GCNGC 7 cut(s) 183, 378, 411, 471, 579, 620, 693
GsaI CCCAGC 1 cut(s) 591
HaeIII GGCC 2 cut(s) 329, 720
HapII CCGG 1 cut(s) 275
HhaI GCGC 1 cut(s) 149
Hin1II CATG 4 cut(s) 328, 493, 713, 742
Hin6I GCGC 1 cut(s) 147
HinP1I GCGC 1 cut(s) 147
HincII GTYRAC 1 cut(s) 553
HindII GTYRAC 1 cut(s) 553
HinfI GANTC 5 cut(s) 176, 238, 592, 637, 761
HpaII CCGG 1 cut(s) 275
Hpy166II GTNNAC 1 cut(s) 553
Hpy188I TCNGA 6 cut(s) 80, 160, 175, 222, 260, 766
Hpy188III TCNNGA 4 cut(s) 385, 449, 641, 739
Hpy8I GTNNAC 1 cut(s) 553
Hpy99I CGWCG 4 cut(s) 172, 175, 235, 391
HpyAV CCTTC 2 cut(s) 197, 340
HpyCH4III ACNGT 1 cut(s) 168
HpyCH4IV ACGT 1 cut(s) 270
HpyCH4V TGCA 6 cut(s) 87, 342, 377, 398, 413, 673
HpyF10VI GCNNNNNNNGC 5 cut(s) 121, 335, 440, 575, 584
HpyF3I CTNAG 4 cut(s) 484, 527, 729, 763
HpySE526I ACGT 1 cut(s) 270
Hsp92II CATG 4 cut(s) 328, 493, 713, 742
HspAI GCGC 1 cut(s) 147
Kzo9I GATC 2 cut(s) 66, 502
LmnI GCTCC 1 cut(s) 689
Lsp1109I GCAGC 6 cut(s) 389, 397, 457, 590, 631, 704
MaeI CTAG 1 cut(s) 459
MaeII ACGT 1 cut(s) 270
MaeIII GTNAC 1 cut(s) 724
MalI GATC 2 cut(s) 68, 504
MbiI CCGCTC 1 cut(s) 23
MboI GATC 2 cut(s) 66, 502
MboII GAAGA 5 cut(s) 48, 51, 54, 203, 712
MhlI GDGCHC 1 cut(s) 37
MlsI TGGCCA 1 cut(s) 720
MluCI AATT 8 cut(s) 26, 89, 154, 293, 372, 684, 786, 801
MluNI TGGCCA 1 cut(s) 720
MlyI GAGTC 2 cut(s) 247, 755
MmeI TCCRAC 3 cut(s) 103, 153, 238
Mox20I TGGCCA 1 cut(s) 720
MroXI GAANNNNTTC 1 cut(s) 207
MscI TGGCCA 1 cut(s) 720
MseI TTAA 1 cut(s) 134
Msp20I TGGCCA 1 cut(s) 720
MspA1I CMGCKG 1 cut(s) 380
MspI CCGG 1 cut(s) 275
MspR9I CCNGG 2 cut(s) 276, 311
MvaI CCWGG 1 cut(s) 311
MwoI GCNNNNNNNGC 5 cut(s) 121, 335, 440, 575, 584
NciI CCSGG 1 cut(s) 276
NdeII GATC 2 cut(s) 66, 502
NlaIII CATG 4 cut(s) 328, 493, 713, 742
NlaIV GGNNCC 2 cut(s) 193, 279
NmeAIII GCCGAG 1 cut(s) 595
NmuCI GTSAC 1 cut(s) 724
PagI TCATGA 1 cut(s) 738
PdmI GAANNNNTTC 1 cut(s) 207
PfeI GAWTC 3 cut(s) 176, 592, 637
PkrI GCNGC 7 cut(s) 184, 379, 412, 472, 580, 621, 694
PleI GAGTC 2 cut(s) 246, 755
PpsI GAGTC 2 cut(s) 246, 755
Psp1406I AACGTT 1 cut(s) 270
Psp6I CCWGG 1 cut(s) 309
PspFI CCCAGC 1 cut(s) 587
PspGI CCWGG 1 cut(s) 309
PspN4I GGNNCC 2 cut(s) 193, 279
PspPI GGNCC 2 cut(s) 192, 278
PstNI CAGNNNCTG 1 cut(s) 587
PvuII CAGCTG 1 cut(s) 380
RsaI GTAC 1 cut(s) 463
RsaNI GTAC 1 cut(s) 462
SaqAI TTAA 1 cut(s) 134
SatI GCNGC 7 cut(s) 183, 378, 411, 471, 579, 620, 693
Sau3AI GATC 2 cut(s) 66, 502
Sau96I GGNCC 2 cut(s) 192, 278
ScaI AGTACT 1 cut(s) 463
SchI GAGTC 2 cut(s) 247, 755
ScrFI CCNGG 2 cut(s) 276, 311
SduI GDGCHC 1 cut(s) 37
SinI GGWCC 2 cut(s) 192, 278
SmlI CTYRAG 1 cut(s) 564
SmoI CTYRAG 1 cut(s) 564
Sse9I AATT 8 cut(s) 26, 89, 154, 293, 372, 684, 786, 801
SsiI CCGC 4 cut(s) 21, 130, 182, 185
SspMI CTAG 1 cut(s) 459
StyD4I CCNGG 2 cut(s) 274, 309
TaaI ACNGT 1 cut(s) 168
TaiI ACGT 1 cut(s) 273
TaqI TCGA 1 cut(s) 65
TasI AATT 8 cut(s) 26, 89, 154, 293, 372, 684, 786, 801
TatI WGTACW 1 cut(s) 461
TauI GCSGC 1 cut(s) 185
TfiI GAWTC 3 cut(s) 176, 592, 637
Tru1I TTAA 1 cut(s) 134
Tru9I TTAA 1 cut(s) 134
TscAI CASTG 2 cut(s) 248, 516
TseFI GTSAC 1 cut(s) 724
TseI GCWGC 6 cut(s) 377, 410, 470, 578, 619, 692
Tsp45I GTSAC 1 cut(s) 724
TspDTI ATGAA 4 cut(s) 17, 322, 727, 755
TspGWI ACGGA 2 cut(s) 270, 274
TspRI CASTG 2 cut(s) 248, 516
VpaK11BI GGWCC 2 cut(s) 192, 278
XapI RAATTY 2 cut(s) 89, 801
XmnI GAANNNNTTC 1 cut(s) 207
XspI CTAG 1 cut(s) 459
ZrmI AGTACT 1 cut(s) 463
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.