RLG00000031635

HB1, ASXL, restriction endonuclease HTH domain

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr7
Physical Location & Seq
Reverse (-)
6926044 .. 6926489
446 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000031635

Sequence Viewer

Length: 372 bp
ATGAAAGGTGATGAACAACGAGAGGAGTATGAGCAAGCAGAGGCACTGGAATCTGACGACGAAGAACAAGTAGTGGGATATGAACAAGGGAACTGGGAAATTGGATTTGATGGGACCTCCAGCGGTTGGAACAGCAGTCTACGAGAACCTAGTGATGAGGAGATGGATGCTTCTGAAGATGATAATAATGGCATTGAGGGAGTGAGAGAAGAAGATTTGGAAGGGGATGTAGATATGAGTGATGCTTCAGATGAAGTCCCAAACAGGATTATAAACGATGATGGCACTGATTCAGCTTCAGATGATGATGACTACACTCCACTGGTGCGCTGGTCTCAGCCAGAGGTGGAAATCTATCTTGGTTTCAATTAG

Protein Analysis

124

Amino Acids

13.82

Weight (kDa)

4.05

Isoelectric Point (pI)

55.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011708)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 272
AccB7I CCANNNNNTGG 1 cut(s) 126
AccI GTMKAC 1 cut(s) 139
AciI CCGC 1 cut(s) 123
AcuI CTGAAG 3 cut(s) 195, 231, 282
AfiI CCNNNNNNNGG 1 cut(s) 126
AgsI TTSAA 1 cut(s) 367
AjuI GAANNNNNNNTTGG 1 cut(s) 342
AluBI AGCT 1 cut(s) 296
AluI AGCT 1 cut(s) 296
Alw26I GTCTC 1 cut(s) 339
AspLEI GCGC 1 cut(s) 330
AspS9I GGNCC 1 cut(s) 114
AsuHPI GGTGA 1 cut(s) 20
AvaII GGWCC 1 cut(s) 114
BccI CCATC 3 cut(s) 104, 157, 275
BcoDI GTCTC 1 cut(s) 339
BfaI CTAG 1 cut(s) 150
Bme18I GGWCC 1 cut(s) 114
BmgT120I GGNCC 1 cut(s) 114
BmiI GGNNCC 1 cut(s) 115
BmrI ACTGGG 1 cut(s) 103
BmsI GCATC 2 cut(s) 157, 232
BmuI ACTGGG 1 cut(s) 103
BpmI CTGGAG 1 cut(s) 103
BsaI GGTCTC 1 cut(s) 339
Bsc4I CCNNNNNNNGG 1 cut(s) 126
Bse1I ACTGG 3 cut(s) 51, 98, 327
BseGI GGATG 2 cut(s) 172, 232
BseLI CCNNNNNNNGG 1 cut(s) 126
BseMII CTCAG 1 cut(s) 350
BseNI ACTGG 3 cut(s) 51, 98, 327
BseRI GAGGAG 2 cut(s) 38, 173
BslFI GGGAC 2 cut(s) 127, 242
BslI CCNNNNNNNGG 1 cut(s) 126
BsmAI GTCTC 1 cut(s) 339
BsmFI GGGAC 2 cut(s) 127, 242
Bso31I GGTCTC 1 cut(s) 339
BspACI CCGC 1 cut(s) 123
BspCNI CTCAG 1 cut(s) 349
BspLI GGNNCC 1 cut(s) 115
BspTNI GGTCTC 1 cut(s) 339
BsrI ACTGG 3 cut(s) 51, 98, 327
BstC8I GCNNGC 1 cut(s) 36
BstDEI CTNAG 1 cut(s) 336
BstF5I GGATG 2 cut(s) 172, 232
BstHHI GCGC 1 cut(s) 330
BstMAI GTCTC 1 cut(s) 339
BtsCI GGATG 2 cut(s) 172, 232
BtsIMutI CAGTG 3 cut(s) 44, 285, 320
Cac8I GCNNGC 1 cut(s) 36
CfoI GCGC 1 cut(s) 330
Cfr13I GGNCC 1 cut(s) 114
CviJI RGCY 2 cut(s) 296, 340
CviKI_1 RGCY 2 cut(s) 296, 340
DdeI CTNAG 1 cut(s) 336
Eco31I GGTCTC 1 cut(s) 339
Eco47I GGWCC 1 cut(s) 114
Eco57I CTGAAG 3 cut(s) 195, 231, 282
EcoO109I RGGNCCY 1 cut(s) 114
FaiI YATR 4 cut(s) 30, 81, 236, 272
FaqI GGGAC 2 cut(s) 127, 242
FblI GTMKAC 1 cut(s) 139
FokI GGATG 2 cut(s) 179, 239
FspBI CTAG 1 cut(s) 150
GlaI GCGC 1 cut(s) 329
GsuI CTGGAG 1 cut(s) 103
HhaI GCGC 1 cut(s) 330
Hin6I GCGC 1 cut(s) 328
HinP1I GCGC 1 cut(s) 328
HinfI GANTC 2 cut(s) 50, 290
HphI GGTGA 1 cut(s) 20
Hpy166II GTNNAC 1 cut(s) 140
Hpy188I TCNGA 4 cut(s) 55, 175, 250, 301
Hpy8I GTNNAC 1 cut(s) 140
Hpy99I CGWCG 1 cut(s) 62
HpyAV CCTTC 1 cut(s) 215
HpyF3I CTNAG 1 cut(s) 336
HspAI GCGC 1 cut(s) 328
LpnPI CCDG 7 cut(s) 32, 79, 133, 250, 308, 316, 354
LweI GCATC 2 cut(s) 157, 232
MaeI CTAG 1 cut(s) 150
MboII GAAGA 4 cut(s) 74, 188, 221, 224
MluCI AATT 2 cut(s) 99, 367
MmeI TCCRAC 1 cut(s) 107
MnlI CCTC 6 cut(s) 16, 34, 127, 151, 190, 337
MspA1I CMGCKG 1 cut(s) 123
NlaIV GGNNCC 1 cut(s) 115
PfeI GAWTC 2 cut(s) 50, 290
PflMI CCANNNNNTGG 1 cut(s) 126
PpuMI RGGWCCY 1 cut(s) 114
PsiI TTATAA 1 cut(s) 272
Psp5II RGGWCCY 1 cut(s) 114
PspN4I GGNNCC 1 cut(s) 115
PspPI GGNCC 1 cut(s) 114
PspPPI RGGWCCY 1 cut(s) 114
Sau96I GGNCC 1 cut(s) 114
SetI ASST 5 cut(s) 10, 119, 151, 298, 348
SfaNI GCATC 2 cut(s) 157, 232
SinI GGWCC 1 cut(s) 114
Sse9I AATT 2 cut(s) 99, 367
SsiI CCGC 1 cut(s) 123
SspMI CTAG 1 cut(s) 150
TasI AATT 2 cut(s) 99, 367
TfiI GAWTC 2 cut(s) 50, 290
TscAI CASTG 3 cut(s) 51, 292, 327
TspDTI ATGAA 4 cut(s) 17, 27, 96, 267
TspRI CASTG 3 cut(s) 51, 292, 327
Van91I CCANNNNNTGG 1 cut(s) 126
VpaK11BI GGWCC 1 cut(s) 114
XcmI CCANNNNNNNNNTGG 1 cut(s) 327
XmiI GTMKAC 1 cut(s) 139
XspI CTAG 1 cut(s) 150
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.