Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0006233.1

Orthogroup ID

OG0011708

Physical Location & Seq

Genomic Coordinates Forward (+)

116823 .. 125412

Gene Structure 8590 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0006233.1_g000030.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 4611 bp

atggagggttcggaaggagataatcagaatcggaaccatgagaatagcaatagtaaattgaacaattccggcgagggaggcaagcccaagcgccagatgaagacgccgtttcagctcgaaaccctagagaaggcctatgcgttggagacgtacccatcggagtcgattagggcggagctgtcggagaaattggggctttccgatcggcagttgcagatgtggttctgtcacagaaggctgaaggataagaaggaaggaggttcgggttcgggtccgggtccgggtccgggtccaggaccggcgaagaagcagaggaaatcagtggcggtgttgccggagcctccaattgatgacttggcacatgggtcggagccggcgagtgactatgggtcgggttcgggctccggctcgagcccatttggtcatgcagaccgcaatgtggtgtccaggagtgttgttgttgaggatatgccaaggaggaggcattatgagtcacagcagtcgattacggagcttagagccattgctattgtggaagctcaattgggagagccattaagggaagatggccctgtgcttgggatagagtttgatcaattgcccccggatgcattcggggcacctctagttgcagagcagcagaagcggcatgatgcaaaactaaataaaggtactccgagatctctccatgaatatccatatcttcaagaccaccccattattcggcctgatgtatatggacaagttgctcaatctcattttcatgattcagcaattgatggtccaactgcaagagcttcaccatttgcaagtggaaatgaacagttgtcaagggttcacggtggccacagtcgggctcgtcttctgtcacaacaggagaagcaagcagtggccttttcatctcctggtgatgatggcttacctcaaagggacccctttatcaatgttagaatgaatactcaatatggtgaacccactattattgcaccggaaaactctaatgtattgtctgatggtcaaattaatgacactatgctgagaatggagaggaaacgcaagagtgaagaagtcagaatggctaaagaagtagaagctcatgaagttcgaattcggaaggagctggagaaacaagatattctgaggagaaagaatgaggaaagaatgaggaaagaaatggaaaggcaagaccgtgaaaggcgaaaggaggaagagaggttgatgcgtgagaggcagcgagaggaagagagatcaaagaaggagcaaaaacgtgaaatcgaacgaagggagaagtttttgcaaaaggaacatataagagctgagaaaaggaggcaaaaggaagagctccgaaaagagagagaggaagtgagacgcaaagctgcacttgagaaggctactgcaagaaggcttcttaataaatctatggaactttatgaggatgagcaactagagctaatggagttggctgctgcaagcaagggattatcctcaataattagtattgatcctgacaccaaccttgatgaattcagagatgatctgacggcatttccaccgaagtctgtgctattgaaaaaaccatttgcagttcatccgtggatcgattcagaggagaacatcggtaactttctcatggtttggagatttttgattacatttgcagatgttcttgagttatggccttttactgtggatgagtttgttcaagcttttcatgactatgattcaaggttgttaggagagattcatgttgctctcttgaggttgattataaaggatatagaagatgttgcaaggacaccttctactggactaggtctcaatcaaaatggtgctgctaatcctggaggtggacatccacagattgttgaaggagcatatgcgtggggatttgacataaggaactggcagaagcacttaaatctgctaacatggcctgaaatttttcgccaactagcactctctgctggatttgggccacagttgaagaaaaggagtatctcatggtcgtacttgcctgataatgatgagggtaaaggttgtcgtgatgtaatttcaactctccgcaatggttcagcagctgaaaatgcatttgcaataatgcaagaaaagggcttattagctccacggagatccagacatcggttgacgccaggaactgtaaagtttgcagcttttcatgtcctttctcttgagggaaacaagggattgacggtgttagaacttgctgacaagattcagaaatctggccttcgagacctgacaacaagcaagactccagaggcttcaatttcagttgctctgacaagagatactaagctttttgaaagaattgctccttcaacatatcgtgtacgatctgcttacagaaaggaccctattgatgctgaggccatactttctgcagctaggaagaaggttcagatatttgaaaatgggattttagctgcagaagatgtcgatgaggttgaaagagatgatgccgaagaggttgagagagatgaagactctgattgtgatgacgttgatgaggaccctgaagttgatgacttagctactccagccatagtgaagaaatcccctgatcagtttaatgaagtgactcctttttcagagaatggacaggaaaatttatgcattgatgttgcaccaactgtgcaaaatgagtttgataaggatgtttcatctttccctgttactgcttccaaagaggcagacggtccgagtgcttcctccaagcagtgtgtttctggtgtagaaattagtactagcaatcttgatcaagaaaatatggagattgatgagagcaaggcaggtgagtcatgggttcaagggctcacagaaggggattattctgatctcagtgtcgaagagcgtcttagttctcttgtttccttaattggtattgcaaatgaaggaaactcgattcgtgttgttcttgaggatcgcttagaagcagcaaatgctcttaagaagcaaatgtgggcagaggcacagcttgacaaaagtcgcctaaaagaagagaatgtgagtaaatttgatattccatctttcatgggaggcaaagctgaagcacatgttcccggagtggaagacggccaaagtcctctactggatgtttataatagaatcaatgaggaaggagctgcagaaactcaaaattcaaatcattgttcacaagtacttctgaatggtgtgcctgttgaaagggccatggtacctcaagatacttccatgggtcctgaaaacatcttgaatcagcaattggcttatgcatcaaaaaagtcacgttcacagttgaaatcatatattgcccacagagcagaggagatgtatgcttacaggtccctccctcttggccaagatcgcaggcataatcgatactggcaatttgttgcatctgcatcgagcaatgatcctggttcaggcagaatctttattgaactaaacaatggaaattggaggcttattgacaccgaggaggtacttaaaatgtctacatttttatcatctgctttacagatcatgcttgaaatgaacaacaaagactgtcgaaagacgtggggagcaaaactgaatgcgtcatcatctgttgaagatcttctgcagatgttaactgtgtttgagactgcgatgaaacgagactttgtgtcatcaaactttgcagcgactgatgaattactgggctccagcaaacagtcagtgattgctaatcgtgattatctagacaccaaatcagtttctgtacttccttggataccacataccacggcagctgtggctctgagggtttatgagatggactcagcaattacatatataccgaatgagaaacctgagcccaatggtgacaaggaagtcggagaacatattaagattcctttgagattcaccccaatgagaaatgatagggagatcgaaccaacagagacagaccacaacgaacaaagtactcacctgaaaagtgcacgaaacagcctcaaacgtggtagaggaggtcgtgagcaaggacgtggtaaaaagtccaaatctggtggtagccggcgaaaagctagaggtaatgagaacgagaatatgagtcaaggattaggacctgtggggcgaagaacgcagggacaagggagtggacggggccgacgtactgttagaaagaggagaatgaagaacagggctgtagaggggacacttataggtcatgtgactgacctacgcagtagccctgacagtggaggggaatcacccagaaacttggctggggaatgggatgatgaaaatatcaatatgatccatatgaaaggtgatgaacaacgagaggagtacgagcaagcagaggcactggaatctgatgacgaagaacaagcagtgggatatgaacaagggaactgggagattggatttgatgggacctccagcggttggaacagcggtctacgagaacctagtgatgaggagatggatgcttctgaagatgataataatggcattgaggaagcgagagaagaagattcggaaggggatgtagatatgagtgatgcttcagatgaagtcccaaacaggattataaatgatgatggcactgattcagcttcagacgatgatgattacagtgattga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000122 GO:0000976 GO:0000977 GO:0000981 GO:0001012 GO:0001067 GO:0001227 GO:0003674 GO:0003676 GO:0003677 GO:0003690 GO:0003700 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0006355 GO:0006357 GO:0008150 GO:0009889 GO:0009890 GO:0009892 GO:0009987 GO:0010468 GO:0010556 GO:0010558 GO:0010605 GO:0010629 GO:0019219 GO:0019222 GO:0030154 GO:0031323 GO:0031324 GO:0031326 GO:0031327 GO:0032502 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043565 GO:0044212 GO:0044424 GO:0044464 GO:0045892 GO:0045934 GO:0048519 GO:0048523 GO:0048869 GO:0050789 GO:0050794 GO:0051171 GO:0051172 GO:0051252 GO:0051253 GO:0060255 GO:0065007 GO:0080090 GO:0097159 GO:0140110 GO:1901363 GO:1902679 GO:1903506 GO:1903507 GO:1990837 GO:2000112 GO:2000113 GO:2001141

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DDT HARE-HTH Homeobox WHIM1 WSD

Protein Analysis

1536

Amino Acids

172.18

Weight (kDa)

5.14

Isoelectric Point (pI)

50.69

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011708)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G28420
fragaria_vesca	FvH4_3g08620
malus_domestica	MD05G1310200.v1.1 MD10G1289100.v1.1
prunus_persica	Prupe.4G052600_v2.0.a1
pyrus_communis	pycom05g28660 pycom10g24170
rosa_chinensis	RchiOBHm_Chr5g0009221
rosa_laevigata	RLG00000031635 RLG00000031641
rosa_multiflora	Rmu_sc0006233.1_g000030
rosa_roxburghii	Rroxscaffold_1G00066840 Rroxscaffold_1G00067540
rosa_rugosa	Rorug04G0441600
rosa_samantha	Rh5AG071400 Rh5BG067900 Rh5CG080200 Rh5DG067900
rosa_wichuraiana	Rw5G006670

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	3 cut(s)	1769, 3120, 4559
AarI	CACCTGC	1 cut(s)	2801
AasI	GACNNNNNNGTC	1 cut(s)	3854
Acc36I	ACCTGC	1 cut(s)	2801
Acc65I	GGTACC	1 cut(s)	3214
AccB1I	GGYRCC	2 cut(s)	619, 3214
AccB7I	CCANNNNNTGG	1 cut(s)	4413
AccI	GTMKAC	2 cut(s)	3494, 4426
AciI	CCGC	7 cut(s)	173, 326, 433, 646, 2062, 4410, 4422
AclWI	GGATC	6 cut(s)	1496, 1604, 2124, 2949, 3407, 4276
AcoI	YGGCCR	3 cut(s)	844, 3094, 3355
AcsI	RAATTY	6 cut(s)	1107, 1523, 1938, 2626, 3032, 3157
AcuI	CTGAAG	6 cut(s)	260, 2556, 3087, 4482, 4518, 4569
AcyI	GRCGYC	2 cut(s)	104, 2147
AflII	CTTAAG	1 cut(s)	2966
AflIII	ACRYGT	1 cut(s)	3073
AhdI	GACNNNNNGTC	2 cut(s)	388, 3646
AjiI	CACGTC	2 cut(s)	3558, 4010
AjnI	CCWGG	6 cut(s)	292, 446, 904, 1840, 2149, 3415
AjuI	GAANNNNNNNTTGG	2 cut(s)	3245, 3277
Alw21I	GWGCWC	2 cut(s)	1344, 3967
Alw26I	GTCTC	7 cut(s)	140, 1360, 1820, 2247, 3617, 3633, 3920
Alw44I	GTGCAC	1 cut(s)	3963
AlwI	GGATC	6 cut(s)	1496, 1604, 2124, 2949, 3407, 4276
AlwNI	CAGNNNCTG	4 cut(s)	2078, 2156, 3668, 3740
Ama87I	CYCGRG	1 cut(s)	409
ApaLI	GTGCAC	1 cut(s)	3963
ApoI	RAATTY	6 cut(s)	1107, 1523, 1938, 2626, 3032, 3157
AseI	ATTAAT	1 cut(s)	1023
Asp700I	GAANNNNTTC	2 cut(s)	1941, 3597
Asp718I	GGTACC	1 cut(s)	3214
AspLEI	GCGC	1 cut(s)	93
AsuC2I	CCSGG	5 cut(s)	276, 282, 288, 605, 3081
AsuHPI	GGTGA	9 cut(s)	792, 920, 980, 2825, 3857, 3880, 3944, 4227, 4307
AsuII	TTCGAA	1 cut(s)	1105
AvaI	CYCGRG	1 cut(s)	409
BaeGI	GKGCMC	2 cut(s)	622, 3967
BalI	TGGCCA	2 cut(s)	846, 3357
BanI	GGYRCC	2 cut(s)	619, 3214
BanII	GRGCYC	7 cut(s)	404, 416, 859, 1344, 2835, 3686, 3840
BbsI	GAAGAC	4 cut(s)	107, 854, 2508, 3096
Bbv12I	GWGCWC	2 cut(s)	1344, 3967
BbvCI	CCTCAGC	1 cut(s)	2385
BceAI	ACGGC	4 cut(s)	91, 1557, 3109, 3783
BcgI	CGANNNNNNTGC	6 cut(s)	348, 382, 1543, 1577, 3384, 3418
BciT130I	CCWGG	6 cut(s)	294, 448, 906, 1842, 2151, 3417
BciVI	GTATCC	1 cut(s)	3747
BclI	TGATCA	3 cut(s)	592, 2581, 2776
BcnI	CCSGG	5 cut(s)	276, 282, 288, 605, 3081
BcoDI	GTCTC	7 cut(s)	140, 1360, 1820, 2247, 3617, 3633, 3920
BfmI	CTRYAG	5 cut(s)	2400, 2445, 3144, 3602, 4170
BfoI	RGCGCY	1 cut(s)	94
BfrI	CTTAAG	1 cut(s)	2966
BfuAI	ACCTGC	1 cut(s)	2801
BfuI	GTATCC	1 cut(s)	3747
BglII	AGATCT	2 cut(s)	680, 3595
BmcAI	AGTACT	3 cut(s)	2764, 3180, 3949
BmeRI	GACNNNNNGTC	2 cut(s)	388, 3646
BmeT110I	CYCGRG	1 cut(s)	409
BmgBI	CACGTC	2 cut(s)	3558, 4010
BmrI	ACTGGG	2 cut(s)	3689, 4390
BmuI	ACTGGG	2 cut(s)	3689, 4390
BoxI	GACNNNNGTC	1 cut(s)	3003
BpiI	GAAGAC	4 cut(s)	107, 854, 2508, 3096
BplI	GAGNNNNNCTC	2 cut(s)	3785, 3817
BpmI	CTGGAG	6 cut(s)	1142, 1863, 2259, 2541, 3670, 4390
Bpu10I	CCTNAGC	2 cut(s)	2385, 3834
Bpu14I	TTCGAA	1 cut(s)	1105
BpuEI	CTTGAG	6 cut(s)	1403, 1688, 1777, 2210, 2957, 3204
BpuMI	CCSGG	5 cut(s)	276, 282, 288, 605, 3081
Bsa29I	ATCGAT	2 cut(s)	1599, 3376
BsaHI	GRCGYC	2 cut(s)	104, 2147
BsaI	GGTCTC	2 cut(s)	1820, 2247
BsaJI	CCNNGG	9 cut(s)	473, 603, 1592, 2123, 3210, 3231, 3474, 3749, 3765
BsaWI	WCCGGW	1 cut(s)	988
Bse118I	RCCGGY	3 cut(s)	298, 373, 4038
Bse1I	ACTGG	7 cut(s)	1810, 1907, 3114, 3386, 3684, 4338, 4385
Bse3DI	GCAATG	4 cut(s)	442, 522, 2071, 3415
BseBI	CCWGG	6 cut(s)	294, 448, 906, 1842, 2151, 3417
BseCI	ATCGAT	2 cut(s)	1599, 3376
BseDI	CCNNGG	9 cut(s)	473, 603, 1592, 2123, 3210, 3231, 3474, 3749, 3765
BseMI	GCAATG	4 cut(s)	442, 522, 2071, 3415
BseMII	CTCAG	8 cut(s)	1028, 1130, 1308, 2376, 2872, 3773, 3816, 3825
BseNI	ACTGG	7 cut(s)	1810, 1907, 3114, 3386, 3684, 4338, 4385
BseRI	GAGGAG	9 cut(s)	493, 1156, 1622, 3338, 3491, 4005, 4165, 4325, 4460
BseSI	GKGCMC	2 cut(s)	622, 3967
BseYI	CCCAGC	1 cut(s)	4250
BsgI	GTGCAG	1 cut(s)	1362
Bsh1285I	CGRYCG	1 cut(s)	205
BshNI	GGYRCC	2 cut(s)	619, 3214
BshVI	ATCGAT	2 cut(s)	1599, 3376
BsiEI	CGRYCG	1 cut(s)	205
BsiHKAI	GWGCWC	2 cut(s)	1344, 3967
BsiHKCI	CYCGRG	1 cut(s)	409
BslFI	GGGAC	6 cut(s)	944, 3328, 4125, 4192, 4414, 4529
BsmAI	GTCTC	7 cut(s)	140, 1360, 1820, 2247, 3617, 3633, 3920
BsmBI	CGTCTC	2 cut(s)	140, 1360
BsmFI	GGGAC	6 cut(s)	944, 3328, 4125, 4192, 4414, 4529
BsmI	GAATGC	2 cut(s)	611, 3580
Bso31I	GGTCTC	2 cut(s)	1820, 2247
BsoBI	CYCGRG	1 cut(s)	409
Bsp119I	TTCGAA	1 cut(s)	1105
Bsp1286I	GDGCHC	9 cut(s)	404, 416, 622, 859, 1344, 2835, 3686, 3840, 3967
Bsp19I	CCATGG	2 cut(s)	3210, 3231
BspACI	CCGC	7 cut(s)	173, 326, 433, 646, 2062, 4410, 4422
BspCNI	CTCAG	8 cut(s)	1029, 1131, 1309, 2377, 2871, 3774, 3815, 3826
BspDI	ATCGAT	2 cut(s)	1599, 3376
BspHI	TCATGA	3 cut(s)	763, 1096, 1711
BspMAI	CTGCAG	4 cut(s)	2404, 2449, 3148, 3606
BspMI	ACCTGC	1 cut(s)	2801
BspPI	GGATC	6 cut(s)	1496, 1604, 2124, 2949, 3407, 4276
BspQI	GCTCTTC	2 cut(s)	1332, 2862
BspT104I	TTCGAA	1 cut(s)	1105
BspT107I	GGYRCC	2 cut(s)	619, 3214
BspTI	CTTAAG	1 cut(s)	2966
BspTNI	GGTCTC	2 cut(s)	1820, 2247
BsrDI	GCAATG	4 cut(s)	442, 522, 2071, 3415
BsrFI	RCCGGY	3 cut(s)	298, 373, 4038
BsrI	ACTGG	7 cut(s)	1810, 1907, 3114, 3386, 3684, 4338, 4385
BssAI	RCCGGY	3 cut(s)	298, 373, 4038
BssECI	CCNNGG	9 cut(s)	473, 603, 1592, 2123, 3210, 3231, 3474, 3749, 3765
BssNI	GRCGYC	2 cut(s)	104, 2147
BssT1I	CCWWGG	4 cut(s)	473, 3210, 3231, 3749
Bst2UI	CCWGG	6 cut(s)	294, 448, 906, 1842, 2151, 3417
Bst6I	CTCTTC	6 cut(s)	1203, 1236, 1332, 2478, 2862, 3012
BstACI	GRCGYC	2 cut(s)	104, 2147
BstAFI	CTTAAG	1 cut(s)	2966
BstAPI	GCANNNNNTGC	2 cut(s)	1961, 2960
BstBI	TTCGAA	1 cut(s)	1105
BstC8I	GCNNGC	7 cut(s)	83, 375, 885, 1471, 3368, 4040, 4323
BstDSI	CCRYGG	5 cut(s)	1592, 2123, 3210, 3231, 3765
BstENI	CCTNNNNNAGG	2 cut(s)	128, 3420
BstH2I	RGCGCY	1 cut(s)	94
BstHHI	GCGC	1 cut(s)	93
BstMAI	GTCTC	7 cut(s)	140, 1360, 1820, 2247, 3617, 3633, 3920
BstMCI	CGRYCG	1 cut(s)	205
BstNI	CCWGG	6 cut(s)	294, 448, 906, 1842, 2151, 3417
BstNSI	RCATGY	1 cut(s)	3077
BstPAI	GACNNNNGTC	1 cut(s)	3003
BstSFI	CTRYAG	5 cut(s)	2400, 2445, 3144, 3602, 4170
BstSLI	GKGCMC	2 cut(s)	622, 3967
BstV2I	GAAGAC	4 cut(s)	107, 854, 2508, 3096
BstX2I	RGATCY	3 cut(s)	680, 2129, 3595
BstXI	CCANNNNNNTGG	1 cut(s)	4246
BstYI	RGATCY	3 cut(s)	680, 2129, 3595
Bsu15I	ATCGAT	2 cut(s)	1599, 3376
BsuI	GTATCC	1 cut(s)	3747
BsuTUI	ATCGAT	2 cut(s)	1599, 3376
BtgI	CCRYGG	5 cut(s)	1592, 2123, 3210, 3231, 3765
BtgZI	GCGATG	1 cut(s)	3644
BtrI	CACGTC	2 cut(s)	3558, 4010
BtsI	GCAGTG	3 cut(s)	894, 2744, 4365
BveI	ACCTGC	1 cut(s)	2801
Cac8I	GCNNGC	7 cut(s)	83, 375, 885, 1471, 3368, 4040, 4323
CaiI	CAGNNNCTG	4 cut(s)	2078, 2156, 3668, 3740
CciI	TCATGA	3 cut(s)	763, 1096, 1711
CfoI	GCGC	1 cut(s)	93
Cfr10I	RCCGGY	3 cut(s)	298, 373, 4038
ClaI	ATCGAT	2 cut(s)	1599, 3376
CpoI	CGGWCCG	1 cut(s)	2717
CseI	GACGC	5 cut(s)	112, 1377, 2155, 2861, 3567
CspCI	CAANNNNNGTGG	4 cut(s)	964, 999, 4012, 4047
CspI	CGGWCCG	1 cut(s)	2717
DrdI	GACNNNNNNGTC	1 cut(s)	3854
DriI	GACNNNNNGTC	2 cut(s)	388, 3646
DseDI	GACNNNNNNGTC	1 cut(s)	3854
EaeI	YGGCCR	3 cut(s)	844, 3094, 3355
Eam1104I	CTCTTC	6 cut(s)	1203, 1236, 1332, 2478, 2862, 3012
Eam1105I	GACNNNNNGTC	2 cut(s)	388, 3646
EarI	CTCTTC	6 cut(s)	1203, 1236, 1332, 2478, 2862, 3012
EciI	GGCGGA	1 cut(s)	188
Ecl136II	GAGCTC	1 cut(s)	1342
Eco130I	CCWWGG	4 cut(s)	473, 3210, 3231, 3749
Eco147I	AGGCCT	1 cut(s)	134
Eco24I	GRGCYC	7 cut(s)	404, 416, 859, 1344, 2835, 3686, 3840
Eco31I	GGTCTC	2 cut(s)	1820, 2247
Eco53kI	GAGCTC	1 cut(s)	1342
Eco57I	CTGAAG	6 cut(s)	260, 2556, 3087, 4482, 4518, 4569
Eco88I	CYCGRG	1 cut(s)	409
EcoICRI	GAGCTC	1 cut(s)	1342
EcoNI	CCTNNNNNAGG	2 cut(s)	128, 3420
EcoO109I	RGGNCCY	7 cut(s)	931, 2371, 2530, 3236, 3342, 4088, 4401
EcoRI	GAATTC	2 cut(s)	1107, 1523
EcoRII	CCWGG	6 cut(s)	292, 446, 904, 1840, 2149, 3415
EcoT14I	CCWWGG	4 cut(s)	473, 3210, 3231, 3749
EcoT22I	ATGCAT	4 cut(s)	613, 2089, 2636, 3274
EcoT38I	GRGCYC	7 cut(s)	404, 416, 859, 1344, 2835, 3686, 3840
ErhI	CCWWGG	4 cut(s)	473, 3210, 3231, 3749
Esp3I	CGTCTC	2 cut(s)	140, 1360
FalI	AAGNNNNNCTT	6 cut(s)	1365, 1397, 1783, 1815, 2859, 2891
FaqI	GGGAC	6 cut(s)	944, 3328, 4125, 4192, 4414, 4529
FauNDI	CATATG	2 cut(s)	1876, 4287
FbaI	TGATCA	3 cut(s)	592, 2581, 2776
FblI	GTMKAC	2 cut(s)	3494, 4426
FriOI	GRGCYC	7 cut(s)	404, 416, 859, 1344, 2835, 3686, 3840
GlaI	GCGC	1 cut(s)	92
GsaI	CCCAGC	1 cut(s)	4254
GsuI	CTGGAG	6 cut(s)	1142, 1863, 2259, 2541, 3670, 4390
HaeII	RGCGCY	1 cut(s)	94
HgaI	GACGC	5 cut(s)	112, 1377, 2155, 2861, 3567
HhaI	GCGC	1 cut(s)	93
Hin1I	GRCGYC	2 cut(s)	104, 2147
Hin6I	GCGC	1 cut(s)	91
HinP1I	GCGC	1 cut(s)	91
HincII	GTYRAC	2 cut(s)	2145, 3612
HindII	GTYRAC	2 cut(s)	2145, 3612
HindIII	AAGCTT	2 cut(s)	1704, 2315
HpaI	GTTAAC	1 cut(s)	3612
HphI	GGTGA	9 cut(s)	792, 920, 980, 2825, 3857, 3880, 3944, 4227, 4307
Hpy99I	CGWCG	1 cut(s)	4137
HpyCH4IV	ACGT	8 cut(s)	149, 1267, 2520, 3286, 3557, 3982, 4009, 4135
HpySE526I	ACGT	8 cut(s)	149, 1267, 2520, 3286, 3557, 3982, 4009, 4135
Hsp92I	GRCGYC	2 cut(s)	104, 2147
HspAI	GCGC	1 cut(s)	91
KflI	GGGWCCC	1 cut(s)	931
KpnI	GGTACC	1 cut(s)	3218
KroI	GCCGGC	2 cut(s)	373, 4038
KroNI	GCCGGC	2 cut(s)	375, 4040
Ksp22I	TGATCA	3 cut(s)	592, 2581, 2776
KspAI	GTTAAC	1 cut(s)	3612
LguI	GCTCTTC	2 cut(s)	1332, 2862
MaeII	ACGT	8 cut(s)	149, 1267, 2520, 3286, 3557, 3982, 4009, 4135
MfeI	CAATTG	5 cut(s)	345, 542, 596, 774, 3260
MflI	RGATCY	3 cut(s)	680, 2129, 3595
MhlI	GDGCHC	9 cut(s)	404, 416, 622, 859, 1344, 2835, 3686, 3840, 3967
MlsI	TGGCCA	2 cut(s)	846, 3357
MluNI	TGGCCA	2 cut(s)	846, 3357
MlyI	GAGTC	8 cut(s)	170, 500, 2266, 2498, 2593, 2825, 3794, 4084
MmeI	TCCRAC	6 cut(s)	123, 162, 348, 809, 3838, 4394
Mox20I	TGGCCA	2 cut(s)	846, 3357
Mph1103I	ATGCAT	4 cut(s)	613, 2089, 2636, 3274
MroNI	GCCGGC	2 cut(s)	373, 4038
MroXI	GAANNNNTTC	2 cut(s)	1941, 3597
MscI	TGGCCA	2 cut(s)	846, 3357
MslI	CAYNNNNRTG	4 cut(s)	762, 1716, 1879, 3893
Msp20I	TGGCCA	2 cut(s)	846, 3357
MspA1I	CMGCKG	4 cut(s)	2078, 3773, 4410, 4422
MspCI	CTTAAG	1 cut(s)	2966
MunI	CAATTG	5 cut(s)	345, 542, 596, 774, 3260
Mva1269I	GAATGC	2 cut(s)	611, 3580
MvaI	CCWGG	6 cut(s)	294, 448, 906, 1842, 2151, 3417
NaeI	GCCGGC	2 cut(s)	375, 4040
NciI	CCSGG	5 cut(s)	276, 282, 288, 605, 3081
NcoI	CCATGG	2 cut(s)	3210, 3231
NdeI	CATATG	2 cut(s)	1876, 4287
NgoMIV	GCCGGC	2 cut(s)	373, 4038
NmuCI	GTSAC	8 cut(s)	227, 380, 492, 867, 2596, 3282, 3845, 4195
NsiI	ATGCAT	4 cut(s)	613, 2089, 2636, 3274
NspI	RCATGY	1 cut(s)	3077
NspV	TTCGAA	1 cut(s)	1105
PaeR7I	CTCGAG	1 cut(s)	409
PagI	TCATGA	3 cut(s)	763, 1096, 1711
PaqCI	CACCTGC	1 cut(s)	2801
PceI	AGGCCT	1 cut(s)	134
PciI	ACATGT	1 cut(s)	3073
PciSI	GCTCTTC	2 cut(s)	1332, 2862
PcsI	WCGNNNNNNNCGW	2 cut(s)	374, 4132
PctI	GAATGC	2 cut(s)	611, 3580
PdiI	GCCGGC	2 cut(s)	375, 4040
PdmI	GAANNNNTTC	2 cut(s)	1941, 3597
PflFI	GACNNNGTC	1 cut(s)	1812
PflMI	CCANNNNNTGG	1 cut(s)	4413
PfoI	TCCNGGA	4 cut(s)	292, 446, 1840, 3079
Ple19I	CGATCG	1 cut(s)	205
PleI	GAGTC	8 cut(s)	169, 499, 2266, 2498, 2593, 2824, 3794, 4083
PpsI	GAGTC	8 cut(s)	169, 499, 2266, 2498, 2593, 2824, 3794, 4083
PpuMI	RGGWCCY	7 cut(s)	931, 2371, 2530, 3236, 3342, 4088, 4401
PscI	ACATGT	1 cut(s)	3073
PshAI	GACNNNNGTC	1 cut(s)	3003
PshBI	ATTAAT	1 cut(s)	1023
PsiI	TTATAA	3 cut(s)	1769, 3120, 4559
Psp124BI	GAGCTC	1 cut(s)	1344
Psp5II	RGGWCCY	7 cut(s)	931, 2371, 2530, 3236, 3342, 4088, 4401
Psp6I	CCWGG	6 cut(s)	292, 446, 904, 1840, 2149, 3415
PspFI	CCCAGC	1 cut(s)	4250
PspGI	CCWGG	6 cut(s)	292, 446, 904, 1840, 2149, 3415
PspPPI	RGGWCCY	7 cut(s)	931, 2371, 2530, 3236, 3342, 4088, 4401
PspXI	VCTCGAGB	1 cut(s)	409
PstI	CTGCAG	4 cut(s)	2404, 2449, 3148, 3606
PstNI	CAGNNNCTG	4 cut(s)	2078, 2156, 3668, 3740
PsuI	RGATCY	3 cut(s)	680, 2129, 3595
PsyI	GACNNNGTC	1 cut(s)	1812
PvuI	CGATCG	1 cut(s)	205
PvuII	CAGCTG	2 cut(s)	2078, 3773
RseI	CAYNNNNRTG	4 cut(s)	762, 1716, 1879, 3893
Rsr2I	CGGWCCG	1 cut(s)	2717
RsrII	CGGWCCG	1 cut(s)	2717
SacI	GAGCTC	1 cut(s)	1344
SapI	GCTCTTC	2 cut(s)	1332, 2862
ScaI	AGTACT	3 cut(s)	2764, 3180, 3949
SchI	GAGTC	8 cut(s)	170, 500, 2266, 2498, 2593, 2825, 3794, 4084
SduI	GDGCHC	9 cut(s)	404, 416, 622, 859, 1344, 2835, 3686, 3840, 3967
SfcI	CTRYAG	5 cut(s)	2400, 2445, 3144, 3602, 4170
Sfr274I	CTCGAG	1 cut(s)	409
SfuI	TTCGAA	1 cut(s)	1105
SlaI	CTCGAG	1 cut(s)	409
SmiMI	CAYNNNNRTG	4 cut(s)	762, 1716, 1879, 3893
SmlI	CTYRAG	8 cut(s)	409, 1382, 1667, 1756, 2189, 2936, 2966, 3219
SmoI	CTYRAG	8 cut(s)	409, 1382, 1667, 1756, 2189, 2936, 2966, 3219
SseBI	AGGCCT	1 cut(s)	134
SsiI	CCGC	7 cut(s)	173, 326, 433, 646, 2062, 4410, 4422
SstI	GAGCTC	1 cut(s)	1344
StuI	AGGCCT	1 cut(s)	134
StyI	CCWWGG	4 cut(s)	473, 3210, 3231, 3749
TaiI	ACGT	8 cut(s)	152, 1270, 2523, 3289, 3560, 3985, 4012, 4138
TatI	WGTACW	4 cut(s)	2762, 3178, 3742, 3947
TauI	GCSGC	1 cut(s)	649
TseFI	GTSAC	8 cut(s)	227, 380, 492, 867, 2596, 3282, 3845, 4195
Tsp45I	GTSAC	8 cut(s)	227, 380, 492, 867, 2596, 3282, 3845, 4195
TspGWI	ACGGA	3 cut(s)	524, 1581, 2140
Tth111I	GACNNNGTC	1 cut(s)	1812
Van91I	CCANNNNNTGG	1 cut(s)	4413
Vha464I	CTTAAG	1 cut(s)	2966
VneI	GTGCAC	1 cut(s)	3963
VspI	ATTAAT	1 cut(s)	1023
XagI	CCTNNNNNAGG	2 cut(s)	128, 3420
XapI	RAATTY	6 cut(s)	1107, 1523, 1938, 2626, 3032, 3157
XbaI	TCTAGA	1 cut(s)	3721
XceI	RCATGY	1 cut(s)	3077
XcmI	CCANNNNNNNNNTGG	2 cut(s)	529, 3772
XhoI	CTCGAG	1 cut(s)	409
XmiI	GTMKAC	2 cut(s)	3494, 4426
XmnI	GAANNNNTTC	2 cut(s)	1941, 3597
ZrmI	AGTACT	3 cut(s)	2764, 3180, 3949
Zsp2I	ATGCAT	4 cut(s)	613, 2089, 2636, 3274

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.