Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co7996526.1

Orthogroup ID

OG0005100

Physical Location & Seq

Genomic Coordinates Forward (+)

87 .. 404

Gene Structure 318 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co7996526.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 318 bp

atgctcatttgctacaggtatgcaacagaacatagatgtggagtggttgtaaaaggaccaagtttaagtggaaacatatcaggaacagaccctttgaaggacaaccgtttacttttgcaagctgaagctctagatggtagtgacgaggcacggcatacagctaaagttgttaacgagttatccaaggaaatatcaaagattctcattgctcatccactgaatgcaaagcgggcctctgaagggaagaacatagctaatgttgtccttttacgaggctgtggtatccggattgaggtcagttatctcaaacctacgtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Metalloenzyme PhosphMutase

Protein Analysis

105

Amino Acids

11.41

Weight (kDa)

9.12

Isoelectric Point (pI)

29.84

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005100)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G30841 AT3G30841 AT4G09520
fragaria_vesca	FvH4_5g30870 FvH4_5g30870 FvH4_6g45710
malus_domestica	MD17G1071600.v1.1
prunus_persica	Prupe.3G243300_v2.0.a1 Prupe.3G243300_v2.0.a1
pyrus_communis	pycom17g07100
rosa_chinensis	RchiOBHm_Chr2g0163861 RchiOBHm_Chr5g0053071
rosa_laevigata	RLG00000021422 RLG00000034774
rosa_multiflora	Rmu_co7996526.1_g000001 Rmu_sc0001181.1_g000008 Rmu_sc0005917.1_g000001 Rmu_sc0037762.1_g000001
rosa_roxburghii	Rroxscaffold_1G00028940 Rroxscaffold_2G00086940
rosa_rugosa	Rorug02G0505000 Rorug05G0268300
rosa_samantha	Rh2AG573100 Rh2BG583800 Rh2CG554800 Rh2DG593400 Rh5AG340800 Rh5BG351300 Rh5DG367700
rosa_wichuraiana	Rw2G047390

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccIII	TCCGGA	1 cut(s)	285
AciI	CCGC	1 cut(s)	229
AcuI	CTGAAG	2 cut(s)	144, 258
AfiI	CCNNNNNNNGG	3 cut(s)	97, 240, 292
AgsI	TTSAA	1 cut(s)	97
AluBI	AGCT	4 cut(s)	122, 128, 161, 254
AluI	AGCT	4 cut(s)	122, 128, 161, 254
Aor13HI	TCCGGA	1 cut(s)	285
AoxI	GGCC	1 cut(s)	231
AspS9I	GGNCC	2 cut(s)	56, 231
AvaII	GGWCC	1 cut(s)	56
BccI	CCATC	1 cut(s)	128
BceAI	ACGGC	1 cut(s)	167
BciVI	GTATCC	1 cut(s)	293
BfaI	CTAG	1 cut(s)	131
BfmI	CTRYAG	1 cut(s)	13
BfuI	GTATCC	1 cut(s)	293
Bme18I	GGWCC	1 cut(s)	56
BmgT120I	GGNCC	2 cut(s)	56, 231
BsaAI	YACGTR	1 cut(s)	315
BsaJI	CCNNGG	1 cut(s)	183
BsaWI	WCCGGW	1 cut(s)	285
BsaXI	ACNNNNNCTCC	2 cut(s)	33, 63
Bsc4I	CCNNNNNNNGG	3 cut(s)	97, 240, 292
Bse3DI	GCAATG	1 cut(s)	204
BseAI	TCCGGA	1 cut(s)	285
BseDI	CCNNGG	1 cut(s)	183
BseGI	GGATG	1 cut(s)	211
BseLI	CCNNNNNNNGG	3 cut(s)	97, 240, 292
BseMI	GCAATG	1 cut(s)	204
BshFI	GGCC	1 cut(s)	233
BsiSI	CCGG	1 cut(s)	286
BslI	CCNNNNNNNGG	3 cut(s)	97, 240, 292
BsmI	GAATGC	1 cut(s)	226
BsnI	GGCC	1 cut(s)	233
Bsp13I	TCCGGA	1 cut(s)	285
BspACI	CCGC	1 cut(s)	229
BspANI	GGCC	1 cut(s)	233
BspEI	TCCGGA	1 cut(s)	285
BsrDI	GCAATG	1 cut(s)	204
BssECI	CCNNGG	1 cut(s)	183
BssT1I	CCWWGG	1 cut(s)	183
Bst4CI	ACNGT	1 cut(s)	107
BstBAI	YACGTR	1 cut(s)	315
BstC8I	GCNNGC	2 cut(s)	120, 231
BstF5I	GGATG	1 cut(s)	211
BstMWI	GCNNNNNNNGC	1 cut(s)	230
BstSFI	CTRYAG	1 cut(s)	13
BsuI	GTATCC	1 cut(s)	293
BsuRI	GGCC	1 cut(s)	233
BtsCI	GGATG	1 cut(s)	211
BtsIMutI	CAGTG	1 cut(s)	215
Cac8I	GCNNGC	2 cut(s)	120, 231
Cfr13I	GGNCC	2 cut(s)	56, 231
CviJI	RGCY	6 cut(s)	122, 128, 161, 233, 254, 276
CviKI_1	RGCY	6 cut(s)	122, 128, 161, 233, 254, 276
Eco130I	CCWWGG	1 cut(s)	183
Eco47I	GGWCC	1 cut(s)	56
Eco57I	CTGAAG	2 cut(s)	144, 258
EcoT14I	CCWWGG	1 cut(s)	183
ErhI	CCWWGG	1 cut(s)	183
FaiI	YATR	5 cut(s)	21, 33, 77, 156, 251
FauI	CCCGC	1 cut(s)	222
FokI	GGATG	1 cut(s)	198
FspBI	CTAG	1 cut(s)	131
HaeIII	GGCC	1 cut(s)	233
HapII	CCGG	1 cut(s)	286
HincII	GTYRAC	1 cut(s)	172
HindII	GTYRAC	1 cut(s)	172
HinfI	GANTC	1 cut(s)	199
HpaI	GTTAAC	1 cut(s)	172
HpaII	CCGG	1 cut(s)	286
Hpy166II	GTNNAC	2 cut(s)	110, 172
Hpy188I	TCNGA	1 cut(s)	238
Hpy188III	TCNNGA	3 cut(s)	81, 131, 286
Hpy8I	GTNNAC	2 cut(s)	110, 172
HpyAV	CCTTC	2 cut(s)	91, 233
HpyCH4III	ACNGT	1 cut(s)	107
HpyCH4IV	ACGT	1 cut(s)	314
HpyCH4V	TGCA	3 cut(s)	23, 118, 224
HpyF10VI	GCNNNNNNNGC	1 cut(s)	230
HpySE526I	ACGT	1 cut(s)	314
Kpn2I	TCCGGA	1 cut(s)	285
KspAI	GTTAAC	1 cut(s)	172
LpnPI	CCDG	2 cut(s)	66, 299
MaeI	CTAG	1 cut(s)	131
MaeII	ACGT	1 cut(s)	314
MaeIII	GTNAC	1 cut(s)	140
MboII	GAAGA	1 cut(s)	256
MnlI	CCTC	4 cut(s)	139, 244, 266, 286
MroI	TCCGGA	1 cut(s)	285
MseI	TTAA	2 cut(s)	65, 171
MslI	CAYNNNNRTG	1 cut(s)	36
MspI	CCGG	1 cut(s)	286
Mva1269I	GAATGC	1 cut(s)	226
MwoI	GCNNNNNNNGC	1 cut(s)	230
NmuCI	GTSAC	1 cut(s)	140
PctI	GAATGC	1 cut(s)	226
PfeI	GAWTC	1 cut(s)	199
Ppu21I	YACGTR	1 cut(s)	315
PspPI	GGNCC	2 cut(s)	56, 231
RseI	CAYNNNNRTG	1 cut(s)	36
SaqAI	TTAA	2 cut(s)	65, 171
Sau96I	GGNCC	2 cut(s)	56, 231
SetI	ASST	8 cut(s)	20, 124, 130, 163, 256, 297, 313, 317
SfcI	CTRYAG	1 cut(s)	13
SinI	GGWCC	1 cut(s)	56
SmiMI	CAYNNNNRTG	1 cut(s)	36
SsiI	CCGC	1 cut(s)	229
SspMI	CTAG	1 cut(s)	131
StyI	CCWWGG	1 cut(s)	183
TaaI	ACNGT	1 cut(s)	107
TaiI	ACGT	1 cut(s)	317
TfiI	GAWTC	1 cut(s)	199
Tru1I	TTAA	2 cut(s)	65, 171
Tru9I	TTAA	2 cut(s)	65, 171
TscAI	CASTG	1 cut(s)	222
TseFI	GTSAC	1 cut(s)	140
Tsp45I	GTSAC	1 cut(s)	140
TspRI	CASTG	1 cut(s)	222
VpaK11BI	GGWCC	1 cut(s)	56
XbaI	TCTAGA	1 cut(s)	130
XspI	CTAG	1 cut(s)	131

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.