Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8039390.1

Orthogroup ID

OG0002616

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 279

Gene Structure 279 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8039390.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 279 bp

caaggtgactgtgttttgcttaaatataataacggagaggaggttggcatgggaaaggtgtttcaggcaagtggccaatggtttgggaggaacttggaggagttgagggcatatgttgtggatatcaaagagcttaaagttagaagagcaatgaagcttccatacccatctatggccacaggtggttcatttgaggaggctgaaacaaagattggcttaatgagagtgttatgggattcaagcaagactttcaaattgcctcctctaaggttaagttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003676 GO:0003677 GO:0003697 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005730 GO:0006355 GO:0008150 GO:0009889 GO:0009890 GO:0009892 GO:0010468 GO:0010556 GO:0010558 GO:0010605 GO:0010629 GO:0019219 GO:0019222 GO:0031323 GO:0031324 GO:0031326 GO:0031327 GO:0031974 GO:0031981 GO:0043226 GO:0043227 GO:0043228 GO:0043229 GO:0043231 GO:0043232 GO:0043233 GO:0044422 GO:0044424 GO:0044428 GO:0044446 GO:0044464 GO:0045892 GO:0045934 GO:0048519 GO:0048523 GO:0050789 GO:0050794 GO:0051171 GO:0051172 GO:0051252 GO:0051253 GO:0060194 GO:0060195 GO:0060255 GO:0065007 GO:0070013 GO:0080090 GO:0097159 GO:1901363 GO:1902679 GO:1903506 GO:1903507 GO:2000112 GO:2000113 GO:2001141

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

92

Amino Acids

10.41

Weight (kDa)

9.17

Isoelectric Point (pI)

35.27

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002616)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G03090 AT4G03090 AT4G03090 AT4G03090 AT4G03090
fragaria_vesca	FvH4_2g24490 FvH4_2g24490 FvH4_2g24490 FvH4_2g24490 FvH4_2g24530 FvH4_2g24530 FvH4_5g24052
malus_domestica	MD02G1277900.v1.1
prunus_persica	Prupe.8G250800_v2.0.a1 Prupe.8G267900_v2.0.a1 Prupe.8G267900_v2.0.a1 Prupe.8G267900_v2.0.a1 Prupe.8G267900_v2.0.a1 Prupe.8G267900_v2.0.a1 Prupe.8G267900_v2.0.a1 Prupe.8G267900_v2.0.a1 Prupe.8G267900_v2.0.a1
pyrus_communis	pycom02g23790 pycom07g03300
rosa_chinensis	RchiOBHm_Chr6g0292351
rosa_laevigata	RLG00000012038
rosa_multiflora	Rmu_co8039390.1_g000001 Rmu_sc0001354.1_g000010 Rmu_sc0011092.1_g000002
rosa_roxburghii	Rroxscaffold_7G00175160
rosa_rugosa	Rorug06G0225700 Rorug06G0225700 Rorug06G0225700 Rorug06G0225800 Rorug06G0225800
rosa_samantha	Rh6AG339000 Rh6BG346400 Rh6CG353300 Rh6DG339200
rosa_wichuraiana	Rw6G029510

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcoI	YGGCCR	2 cut(s)	73, 174
AfiI	CCNNNNNNNGG	1 cut(s)	172
AgsI	TTSAA	2 cut(s)	240, 253
AjuI	GAANNNNNNNTTGG	2 cut(s)	195, 227
AluBI	AGCT	2 cut(s)	133, 157
AluI	AGCT	2 cut(s)	133, 157
AoxI	GGCC	2 cut(s)	73, 174
AsuHPI	GGTGA	1 cut(s)	17
BalI	TGGCCA	2 cut(s)	75, 176
BarI	GAAGNNNNNNTAC	2 cut(s)	146, 178
BccI	CCATC	1 cut(s)	175
BsaXI	ACNNNNNCTCC	2 cut(s)	27, 57
Bsc4I	CCNNNNNNNGG	1 cut(s)	172
Bse3DI	GCAATG	1 cut(s)	156
BseLI	CCNNNNNNNGG	1 cut(s)	172
BseMI	GCAATG	1 cut(s)	156
BseRI	GAGGAG	4 cut(s)	53, 113, 209, 252
BshFI	GGCC	2 cut(s)	75, 176
BslI	CCNNNNNNNGG	1 cut(s)	172
BsnI	GGCC	2 cut(s)	75, 176
BspANI	GGCC	2 cut(s)	75, 176
BspQI	GCTCTTC	1 cut(s)	139
BsrDI	GCAATG	1 cut(s)	156
Bst4CI	ACNGT	1 cut(s)	11
Bst6I	CTCTTC	1 cut(s)	139
BstDEI	CTNAG	1 cut(s)	266
BstXI	CCANNNNNNTGG	1 cut(s)	83
BsuRI	GGCC	2 cut(s)	75, 176
CviAII	CATG	1 cut(s)	49
CviJI	RGCY	6 cut(s)	75, 133, 157, 176, 200, 216
CviKI_1	RGCY	6 cut(s)	75, 133, 157, 176, 200, 216
DdeI	CTNAG	1 cut(s)	266
EaeI	YGGCCR	2 cut(s)	73, 174
Eam1104I	CTCTTC	1 cut(s)	139
EarI	CTCTTC	1 cut(s)	139
Eco32I	GATATC	1 cut(s)	124
EcoRV	GATATC	1 cut(s)	124
FaeI	CATG	1 cut(s)	52
FaiI	YATR	7 cut(s)	27, 50, 112, 114, 163, 173, 232
FalI	AAGNNNNNCTT	4 cut(s)	200, 232, 232, 264
FatI	CATG	1 cut(s)	48
FauNDI	CATATG	1 cut(s)	112
HaeIII	GGCC	2 cut(s)	75, 176
Hin1II	CATG	1 cut(s)	52
HindIII	AAGCTT	1 cut(s)	155
HinfI	GANTC	1 cut(s)	236
HphI	GGTGA	1 cut(s)	17
HpyCH4III	ACNGT	1 cut(s)	11
HpyF3I	CTNAG	1 cut(s)	266
Hsp92II	CATG	1 cut(s)	52
LguI	GCTCTTC	1 cut(s)	139
LpnPI	CCDG	2 cut(s)	50, 165
MaeIII	GTNAC	1 cut(s)	5
MboII	GAAGA	1 cut(s)	156
MlsI	TGGCCA	2 cut(s)	75, 176
MluCI	AATT	1 cut(s)	254
MluNI	TGGCCA	2 cut(s)	75, 176
MnlI	CCTC	9 cut(s)	31, 34, 81, 91, 99, 187, 190, 270, 273
Mox20I	TGGCCA	2 cut(s)	75, 176
MscI	TGGCCA	2 cut(s)	75, 176
MseI	TTAA	5 cut(s)	21, 135, 218, 272, 277
Msp20I	TGGCCA	2 cut(s)	75, 176
NdeI	CATATG	1 cut(s)	112
NlaIII	CATG	1 cut(s)	52
NmuCI	GTSAC	1 cut(s)	5
PciSI	GCTCTTC	1 cut(s)	139
PfeI	GAWTC	1 cut(s)	236
SapI	GCTCTTC	1 cut(s)	139
SaqAI	TTAA	5 cut(s)	21, 135, 218, 272, 277
SetI	ASST	7 cut(s)	7, 45, 60, 135, 159, 184, 272
SgeI	CNNG	8 cut(s)	14, 61, 77, 81, 106, 192, 252, 256
Sse9I	AATT	1 cut(s)	254
TaaI	ACNGT	1 cut(s)	11
TasI	AATT	1 cut(s)	254
TfiI	GAWTC	1 cut(s)	236
Tru1I	TTAA	5 cut(s)	21, 135, 218, 272, 277
Tru9I	TTAA	5 cut(s)	21, 135, 218, 272, 277
TseFI	GTSAC	1 cut(s)	5
Tsp45I	GTSAC	1 cut(s)	5
TspDTI	ATGAA	2 cut(s)	167, 177
TspGWI	ACGGA	1 cut(s)	48

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.