Rmu_co8044182.1_g000001

metalloendopeptidase activity

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8044182.1
Physical Location & Seq
Reverse (-)
1 .. 514
514 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8044182.1_g000001.1.cds

Sequence Viewer

Length: 231 bp
ctgaatctcggatggtatgtcatatctgtaacatcaactcctggcaaggttcacaaagctgttgatgcatgcaagaatgtccttagaggtttgcatagcaacaagatttcccaaagggagctggacagggcaaaacggacgcttctgatgagacatgaagctgagatcaagtcaaatggctactggcttggacttttagctcacttgcaagcttcttctgttccaaggaag

Protein Analysis

77

Amino Acids

8.66

Weight (kDa)

10.29

Isoelectric Point (pI)

31.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AjnI CCWGG 1 cut(s) 40
AluBI AGCT 5 cut(s) 59, 121, 161, 200, 212
AluI AGCT 5 cut(s) 59, 121, 161, 200, 212
Alw26I GTCTC 1 cut(s) 145
BccI CCATC 1 cut(s) 6
BciT130I CCWGG 1 cut(s) 42
BcoDI GTCTC 1 cut(s) 145
Bme1390I CCNGG 1 cut(s) 42
BmrFI CCNGG 1 cut(s) 42
BmsI GCATC 1 cut(s) 55
BsaJI CCNNGG 1 cut(s) 224
BsaXI ACNNNNNCTCC 2 cut(s) 22, 52
Bse1I ACTGG 1 cut(s) 188
BseBI CCWGG 1 cut(s) 42
BseDI CCNNGG 1 cut(s) 224
BseGI GGATG 1 cut(s) 17
BseMII CTCAG 1 cut(s) 153
BseNI ACTGG 1 cut(s) 188
BsmAI GTCTC 1 cut(s) 145
Bsp143I GATC 1 cut(s) 165
BspCNI CTCAG 1 cut(s) 154
BsrI ACTGG 1 cut(s) 188
BssECI CCNNGG 1 cut(s) 224
BssMI GATC 1 cut(s) 165
BssT1I CCWWGG 1 cut(s) 224
Bst2UI CCWGG 1 cut(s) 42
BstC8I GCNNGC 2 cut(s) 70, 210
BstDEI CTNAG 2 cut(s) 83, 162
BstF5I GGATG 1 cut(s) 17
BstKTI GATC 1 cut(s) 168
BstMAI GTCTC 1 cut(s) 145
BstMBI GATC 1 cut(s) 165
BstMWI GCNNNNNNNGC 1 cut(s) 65
BstNI CCWGG 1 cut(s) 42
BstNSI RCATGY 1 cut(s) 72
BstSCI CCNGG 1 cut(s) 40
BtsCI GGATG 1 cut(s) 17
Cac8I GCNNGC 2 cut(s) 70, 210
CseI GACGC 1 cut(s) 148
CviAII CATG 2 cut(s) 69, 155
CviJI RGCY 7 cut(s) 59, 121, 161, 180, 187, 200, 212
CviKI_1 RGCY 7 cut(s) 59, 121, 161, 180, 187, 200, 212
DdeI CTNAG 2 cut(s) 83, 162
DpnI GATC 1 cut(s) 167
DpnII GATC 1 cut(s) 165
Eco130I CCWWGG 1 cut(s) 224
EcoRII CCWGG 1 cut(s) 40
EcoT14I CCWWGG 1 cut(s) 224
EcoT22I ATGCAT 1 cut(s) 70
ErhI CCWWGG 1 cut(s) 224
FaeI CATG 2 cut(s) 72, 158
FaiI YATR 5 cut(s) 18, 23, 70, 96, 156
FatI CATG 2 cut(s) 68, 154
FokI GGATG 1 cut(s) 24
HgaI GACGC 1 cut(s) 148
Hin1II CATG 2 cut(s) 72, 158
HindIII AAGCTT 1 cut(s) 210
HinfI GANTC 1 cut(s) 4
Hpy166II GTNNAC 1 cut(s) 52
Hpy188I TCNGA 2 cut(s) 11, 147
Hpy8I GTNNAC 1 cut(s) 52
HpyCH4V TGCA 4 cut(s) 68, 72, 94, 208
HpyF10VI GCNNNNNNNGC 1 cut(s) 65
HpyF3I CTNAG 2 cut(s) 83, 162
Hsp92II CATG 2 cut(s) 72, 158
Kzo9I GATC 1 cut(s) 165
LmnI GCTCC 1 cut(s) 118
LpnPI CCDG 5 cut(s) 27, 54, 107, 112, 169
LweI GCATC 1 cut(s) 55
MaeIII GTNAC 1 cut(s) 28
MalI GATC 1 cut(s) 167
MboI GATC 1 cut(s) 165
MboII GAAGA 1 cut(s) 207
MnlI CCTC 1 cut(s) 80
Mph1103I ATGCAT 1 cut(s) 70
MspR9I CCNGG 1 cut(s) 42
MvaI CCWGG 1 cut(s) 42
MwoI GCNNNNNNNGC 1 cut(s) 65
NdeII GATC 1 cut(s) 165
NlaIII CATG 2 cut(s) 72, 158
NsiI ATGCAT 1 cut(s) 70
NspI RCATGY 1 cut(s) 72
PaeI GCATGC 1 cut(s) 72
PfeI GAWTC 1 cut(s) 4
Psp6I CCWGG 1 cut(s) 40
PspGI CCWGG 1 cut(s) 40
Sau3AI GATC 1 cut(s) 165
ScrFI CCNGG 1 cut(s) 42
SetI ASST 7 cut(s) 51, 61, 91, 123, 163, 202, 214
SfaNI GCATC 1 cut(s) 55
SphI GCATGC 1 cut(s) 72
StyD4I CCNGG 1 cut(s) 40
StyI CCWWGG 1 cut(s) 224
TfiI GAWTC 1 cut(s) 4
TspDTI ATGAA 1 cut(s) 171
TspGWI ACGGA 1 cut(s) 151
XceI RCATGY 1 cut(s) 72
Zsp2I ATGCAT 1 cut(s) 70
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.