Rmu_co8050736.1_g000001

exocyst complex component

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8050736.1
Physical Location & Seq
Reverse (-)
2 .. 551
550 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8050736.1_g000001.1.cds

Sequence Viewer

Length: 550 bp
atggccaagatgagggagtctctcttgtcggtctgttctatgggattgaaattccaagaaaggcacggtggtttgatcaaccgcctaagtagcattcagcaccgagccatggcctatctggaagaagaattcagaatccttctagaagaatccaaaaccgagtctgatcatcatcactctacagcagctgatcacaaccataaccataaccataacagtaacaaagacagcagcagtggtaacaaaggaaagaacgatcaagaatcacaaccggaatccgagtcagaatcaaataaagaaggggttgttgaatttcccgggttccctgaggaggtcgtgtccaacctgaataaaatagccaccaagatgatctccgccggctacgaatccgagtgttgcgaggtctacatcatctccaggaggcatgcattcgatgaaaatctccacaagctcggcctagagaagcacagcatcgacgacgtgcagaagatgcactgggaagcgttggagagagagatcatgttgtgggtcaaggcattcaagcaatgct
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

183

Amino Acids

21.01

Weight (kDa)

5.79

Isoelectric Point (pI)

70.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 405
AciI CCGC 2 cut(s) 82, 375
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 3 cut(s) 50, 128, 311
AfiI CCNNNNNNNGG 3 cut(s) 12, 109, 331
AgsI TTSAA 3 cut(s) 49, 311, 541
AjiI CACGTC 1 cut(s) 481
AjnI CCWGG 1 cut(s) 416
AluBI AGCT 2 cut(s) 188, 451
AluI AGCT 2 cut(s) 188, 451
Alw26I GTCTC 1 cut(s) 24
AlwNI CAGNNNCTG 1 cut(s) 188
Ama87I CYCGRG 1 cut(s) 317
AoxI GGCC 3 cut(s) 3, 111, 454
ApeKI GCWGC 2 cut(s) 185, 231
ApoI RAATTY 3 cut(s) 50, 128, 311
AsuC2I CCSGG 2 cut(s) 318, 319
AvaI CYCGRG 1 cut(s) 317
AxyI CCTNAGG 1 cut(s) 327
BalI TGGCCA 1 cut(s) 5
BbvI GCAGC 2 cut(s) 197, 243
BciT130I CCWGG 1 cut(s) 418
BclI TGATCA 3 cut(s) 75, 166, 190
BcnI CCSGG 2 cut(s) 318, 319
BcoDI GTCTC 1 cut(s) 24
BfaI CTAG 2 cut(s) 143, 458
BfmI CTRYAG 1 cut(s) 180
BisI GCNGC 2 cut(s) 186, 232
BlsI GCNGC 2 cut(s) 187, 233
Bme1390I CCNGG 3 cut(s) 318, 319, 418
BmeT110I CYCGRG 1 cut(s) 317
BmgBI CACGTC 1 cut(s) 481
BmiI GGNNCC 1 cut(s) 323
BmrFI CCNGG 3 cut(s) 318, 319, 418
BmrI ACTGGG 1 cut(s) 505
BmsI GCATC 2 cut(s) 480, 480
BmuI ACTGGG 1 cut(s) 505
BplI GAGNNNNNCTC 1 cut(s) 36
BpmI CTGGAG 1 cut(s) 400
BpuMI CCSGG 2 cut(s) 318, 319
BsaBI GATNNNNATC 2 cut(s) 171, 438
BsaJI CCNNGG 2 cut(s) 108, 317
BsaWI WCCGGW 1 cut(s) 271
BsaXI ACNNNNNCTCC 4 cut(s) 323, 353, 398, 428
Bsc4I CCNNNNNNNGG 3 cut(s) 12, 109, 331
Bse118I RCCGGY 1 cut(s) 377
Bse1I ACTGG 1 cut(s) 500
Bse21I CCTNAGG 1 cut(s) 327
Bse8I GATNNNNATC 2 cut(s) 171, 438
BseBI CCWGG 1 cut(s) 418
BseDI CCNNGG 2 cut(s) 108, 317
BseJI GATNNNNATC 2 cut(s) 171, 438
BseLI CCNNNNNNNGG 3 cut(s) 12, 109, 331
BseMII CTCAG 1 cut(s) 318
BseNI ACTGG 1 cut(s) 500
BseRI GAGGAG 1 cut(s) 344
BseXI GCAGC 2 cut(s) 197, 243
BsgI GTGCAG 1 cut(s) 503
BshFI GGCC 3 cut(s) 5, 113, 456
BsiHKCI CYCGRG 1 cut(s) 317
BsiSI CCGG 3 cut(s) 272, 318, 378
BslI CCNNNNNNNGG 3 cut(s) 12, 109, 331
BsmAI GTCTC 1 cut(s) 24
BsmI GAATGC 3 cut(s) 93, 428, 536
BsnI GGCC 3 cut(s) 5, 113, 456
BsoBI CYCGRG 1 cut(s) 317
Bsp143I GATC 6 cut(s) 75, 166, 190, 256, 369, 516
Bsp19I CCATGG 1 cut(s) 108
BspACI CCGC 2 cut(s) 82, 375
BspANI GGCC 3 cut(s) 5, 113, 456
BspCNI CTCAG 1 cut(s) 319
BspLI GGNNCC 1 cut(s) 323
BsrFI RCCGGY 1 cut(s) 377
BsrI ACTGG 1 cut(s) 500
BssAI RCCGGY 1 cut(s) 377
BssECI CCNNGG 2 cut(s) 108, 317
BssMI GATC 6 cut(s) 75, 166, 190, 256, 369, 516
BssT1I CCWWGG 1 cut(s) 108
Bst2UI CCWGG 1 cut(s) 418
Bst4CI ACNGT 2 cut(s) 68, 218
BstAPI GCANNNNNTGC 1 cut(s) 490
BstC8I GCNNGC 2 cut(s) 379, 426
BstDEI CTNAG 2 cut(s) 86, 327
BstDSI CCRYGG 1 cut(s) 108
BstKTI GATC 6 cut(s) 78, 169, 193, 259, 372, 519
BstMAI GTCTC 1 cut(s) 24
BstMBI GATC 6 cut(s) 75, 166, 190, 256, 369, 516
BstMWI GCNNNNNNNGC 2 cut(s) 90, 490
BstNI CCWGG 1 cut(s) 418
BstNSI RCATGY 1 cut(s) 428
BstSCI CCNGG 3 cut(s) 316, 317, 416
BstSFI CTRYAG 1 cut(s) 180
BstV1I GCAGC 2 cut(s) 197, 243
Bsu36I CCTNAGG 1 cut(s) 327
BsuRI GGCC 3 cut(s) 5, 113, 456
BtgI CCRYGG 1 cut(s) 108
BtrI CACGTC 1 cut(s) 481
BtsI GCAGTG 1 cut(s) 241
BtsIMutI CAGTG 2 cut(s) 241, 493
Cac8I GCNNGC 2 cut(s) 379, 426
CaiI CAGNNNCTG 1 cut(s) 188
Cfr10I RCCGGY 1 cut(s) 377
Cfr9I CCCGGG 1 cut(s) 317
CviAII CATG 3 cut(s) 109, 425, 520
CviJI RGCY 8 cut(s) 5, 107, 113, 188, 359, 381, 451, 456
CviKI_1 RGCY 8 cut(s) 5, 107, 113, 188, 359, 381, 451, 456
DdeI CTNAG 2 cut(s) 86, 327
DpnI GATC 6 cut(s) 77, 168, 192, 258, 371, 518
DpnII GATC 6 cut(s) 75, 166, 190, 256, 369, 516
EaeI YGGCCR 1 cut(s) 3
EciI GGCGGA 1 cut(s) 364
Eco130I CCWWGG 1 cut(s) 108
Eco81I CCTNAGG 1 cut(s) 327
Eco88I CYCGRG 1 cut(s) 317
EcoRI GAATTC 1 cut(s) 128
EcoRII CCWGG 1 cut(s) 416
EcoT14I CCWWGG 1 cut(s) 108
EcoT22I ATGCAT 1 cut(s) 430
ErhI CCWWGG 1 cut(s) 108
FaeI CATG 3 cut(s) 112, 428, 523
FaiI YATR 7 cut(s) 41, 110, 201, 207, 213, 426, 521
FatI CATG 3 cut(s) 108, 424, 519
FbaI TGATCA 3 cut(s) 75, 166, 190
FblI GTMKAC 1 cut(s) 405
Fnu4HI GCNGC 2 cut(s) 186, 232
Fsp4HI GCNGC 2 cut(s) 186, 232
FspBI CTAG 2 cut(s) 143, 458
GluI GCNGC 2 cut(s) 186, 232
GsuI CTGGAG 1 cut(s) 400
HaeIII GGCC 3 cut(s) 5, 113, 456
HapII CCGG 3 cut(s) 272, 318, 378
Hin1II CATG 3 cut(s) 112, 428, 523
HinfI GANTC 9 cut(s) 17, 135, 149, 161, 263, 275, 281, 287, 386
HpaII CCGG 3 cut(s) 272, 318, 378
Hpy166II GTNNAC 1 cut(s) 406
Hpy188I TCNGA 5 cut(s) 134, 166, 280, 286, 391
Hpy188III TCNNGA 3 cut(s) 119, 143, 260
Hpy8I GTNNAC 1 cut(s) 406
Hpy99I CGWCG 2 cut(s) 479, 482
HpyAV CCTTC 2 cut(s) 149, 293
HpyCH4III ACNGT 2 cut(s) 68, 218
HpyCH4IV ACGT 1 cut(s) 480
HpyCH4V TGCA 3 cut(s) 428, 484, 493
HpyF10VI GCNNNNNNNGC 2 cut(s) 90, 490
HpyF3I CTNAG 2 cut(s) 86, 327
HpySE526I ACGT 1 cut(s) 480
Hsp92II CATG 3 cut(s) 112, 428, 523
KroI GCCGGC 1 cut(s) 377
KroNI GCCGGC 1 cut(s) 379
Ksp22I TGATCA 3 cut(s) 75, 166, 190
Kzo9I GATC 6 cut(s) 75, 166, 190, 256, 369, 516
LpnPI CCDG 9 cut(s) 104, 285, 331, 339, 359, 391, 403, 430, 481
Lsp1109I GCAGC 2 cut(s) 197, 243
LweI GCATC 2 cut(s) 480, 480
MaeI CTAG 2 cut(s) 143, 458
MaeII ACGT 1 cut(s) 480
MaeIII GTNAC 2 cut(s) 218, 239
MalI GATC 6 cut(s) 77, 168, 192, 258, 371, 518
MboI GATC 6 cut(s) 75, 166, 190, 256, 369, 516
MboII GAAGA 4 cut(s) 134, 137, 158, 499
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 3 cut(s) 50, 128, 311
MluNI TGGCCA 1 cut(s) 5
MlyI GAGTC 3 cut(s) 26, 170, 290
MmeI TCCRAC 2 cut(s) 366, 486
MnlI CCTC 5 cut(s) 6, 322, 325, 394, 414
Mox20I TGGCCA 1 cut(s) 5
Mph1103I ATGCAT 1 cut(s) 430
MroNI GCCGGC 1 cut(s) 377
MscI TGGCCA 1 cut(s) 5
MslI CAYNNNNRTG 1 cut(s) 365
Msp20I TGGCCA 1 cut(s) 5
MspA1I CMGCKG 1 cut(s) 188
MspI CCGG 3 cut(s) 272, 318, 378
MspR9I CCNGG 3 cut(s) 318, 319, 418
Mva1269I GAATGC 3 cut(s) 93, 428, 536
MvaI CCWGG 1 cut(s) 418
MwoI GCNNNNNNNGC 2 cut(s) 90, 490
NaeI GCCGGC 1 cut(s) 379
NciI CCSGG 2 cut(s) 318, 319
NcoI CCATGG 1 cut(s) 108
NdeII GATC 6 cut(s) 75, 166, 190, 256, 369, 516
NgoMIV GCCGGC 1 cut(s) 377
NlaIII CATG 3 cut(s) 112, 428, 523
NlaIV GGNNCC 1 cut(s) 323
NmeAIII GCCGAG 1 cut(s) 432
NsiI ATGCAT 1 cut(s) 430
NspI RCATGY 1 cut(s) 428
PaeI GCATGC 1 cut(s) 428
PctI GAATGC 3 cut(s) 93, 428, 536
PdiI GCCGGC 1 cut(s) 379
PfeI GAWTC 6 cut(s) 135, 149, 263, 275, 287, 386
PfoI TCCNGGA 1 cut(s) 416
PkrI GCNGC 2 cut(s) 187, 233
PleI GAGTC 3 cut(s) 25, 169, 289
PpsI GAGTC 3 cut(s) 25, 169, 289
Psp6I CCWGG 1 cut(s) 416
PspGI CCWGG 1 cut(s) 416
PspN4I GGNNCC 1 cut(s) 323
PstNI CAGNNNCTG 1 cut(s) 188
PvuII CAGCTG 1 cut(s) 188
RseI CAYNNNNRTG 1 cut(s) 365
SatI GCNGC 2 cut(s) 186, 232
Sau3AI GATC 6 cut(s) 75, 166, 190, 256, 369, 516
SchI GAGTC 3 cut(s) 26, 170, 290
ScrFI CCNGG 3 cut(s) 318, 319, 418
SetI ASST 6 cut(s) 190, 336, 348, 405, 453, 483
SfaNI GCATC 2 cut(s) 480, 480
SfcI CTRYAG 1 cut(s) 180
SmaI CCCGGG 1 cut(s) 319
SmiMI CAYNNNNRTG 1 cut(s) 365
SphI GCATGC 1 cut(s) 428
Sse9I AATT 3 cut(s) 50, 128, 311
SsiI CCGC 2 cut(s) 82, 375
SspMI CTAG 2 cut(s) 143, 458
StyD4I CCNGG 3 cut(s) 316, 317, 416
StyI CCWWGG 1 cut(s) 108
TaaI ACNGT 2 cut(s) 68, 218
TaiI ACGT 1 cut(s) 483
TaqI TCGA 2 cut(s) 432, 474
TaqII GACCGA 1 cut(s) 19
TasI AATT 3 cut(s) 50, 128, 311
TfiI GAWTC 6 cut(s) 135, 149, 263, 275, 287, 386
TscAI CASTG 2 cut(s) 241, 500
TseI GCWGC 2 cut(s) 185, 231
TspDTI ATGAA 1 cut(s) 450
TspMI CCCGGG 1 cut(s) 317
TspRI CASTG 2 cut(s) 241, 500
XapI RAATTY 3 cut(s) 50, 128, 311
XbaI TCTAGA 1 cut(s) 142
XceI RCATGY 1 cut(s) 428
XcmI CCANNNNNNNNNTGG 1 cut(s) 115
XmaI CCCGGG 1 cut(s) 317
XmiI GTMKAC 1 cut(s) 405
XspI CTAG 2 cut(s) 143, 458
Zsp2I ATGCAT 1 cut(s) 430
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.