Rmu_co8077708.1_g000001

HNH nucleases

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8077708.1
OG0010466
Physical Location & Seq
Forward (+)
1 .. 371
371 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8077708.1_g000001.1.cds

Sequence Viewer

Length: 158 bp
ataaggagcttgacataattgaaatggctgtttacggtgatgtggtccggccaggaaaccagtgccgatgcagaactgtagccgagatgctgggccaggtcaagtcaaaagacaaaactgccgcttgcaagttgccacatagcagtgaggctctatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
HNH

Protein Analysis

51

Amino Acids

5.59

Weight (kDa)

7.93

Isoelectric Point (pI)

31.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 122
AcoI YGGCCR 1 cut(s) 49
AgsI TTSAA 1 cut(s) 22
AjnI CCWGG 2 cut(s) 51, 95
AluBI AGCT 1 cut(s) 9
AluI AGCT 1 cut(s) 9
AoxI GGCC 2 cut(s) 49, 93
AspS9I GGNCC 2 cut(s) 45, 93
AsuHPI GGTGA 1 cut(s) 49
AvaII GGWCC 1 cut(s) 45
BciT130I CCWGG 2 cut(s) 53, 97
BfmI CTRYAG 2 cut(s) 77, 154
BisI GCNGC 1 cut(s) 122
BlsI GCNGC 1 cut(s) 123
Bme1390I CCNGG 2 cut(s) 53, 97
Bme18I GGWCC 1 cut(s) 45
BmgT120I GGNCC 2 cut(s) 45, 93
BmrFI CCNGG 2 cut(s) 53, 97
BmsI GCATC 2 cut(s) 58, 77
Bse1I ACTGG 1 cut(s) 60
BseBI CCWGG 2 cut(s) 53, 97
BseNI ACTGG 1 cut(s) 60
BseYI CCCAGC 1 cut(s) 90
BshFI GGCC 2 cut(s) 51, 95
BsiSI CCGG 1 cut(s) 48
BsnI GGCC 2 cut(s) 51, 95
BspACI CCGC 1 cut(s) 122
BspANI GGCC 2 cut(s) 51, 95
BsrI ACTGG 1 cut(s) 60
Bst2UI CCWGG 2 cut(s) 53, 97
Bst4CI ACNGT 2 cut(s) 37, 78
BstC8I GCNNGC 1 cut(s) 126
BstNI CCWGG 2 cut(s) 53, 97
BstSCI CCNGG 2 cut(s) 51, 95
BstSFI CTRYAG 2 cut(s) 77, 154
BsuRI GGCC 2 cut(s) 51, 95
BtsI GCAGTG 1 cut(s) 150
BtsIMutI CAGTG 2 cut(s) 67, 150
Cac8I GCNNGC 1 cut(s) 126
Cfr13I GGNCC 2 cut(s) 45, 93
CviJI RGCY 6 cut(s) 9, 28, 51, 82, 95, 151
CviKI_1 RGCY 6 cut(s) 9, 28, 51, 82, 95, 151
EaeI YGGCCR 1 cut(s) 49
Eco47I GGWCC 1 cut(s) 45
EcoRII CCWGG 2 cut(s) 51, 95
FaiI YATR 3 cut(s) 16, 140, 156
Fnu4HI GCNGC 1 cut(s) 122
Fsp4HI GCNGC 1 cut(s) 122
GluI GCNGC 1 cut(s) 122
GsaI CCCAGC 1 cut(s) 94
HaeIII GGCC 2 cut(s) 51, 95
HapII CCGG 1 cut(s) 48
HpaII CCGG 1 cut(s) 48
HphI GGTGA 1 cut(s) 49
Hpy166II GTNNAC 1 cut(s) 33
Hpy8I GTNNAC 1 cut(s) 33
HpyCH4III ACNGT 2 cut(s) 37, 78
HpyCH4V TGCA 2 cut(s) 71, 128
LmnI GCTCC 1 cut(s) 6
LpnPI CCDG 7 cut(s) 38, 61, 65, 73, 76, 82, 109
LweI GCATC 2 cut(s) 58, 77
MluCI AATT 1 cut(s) 17
MnlI CCTC 1 cut(s) 141
MslI CAYNNNNRTG 1 cut(s) 143
MspI CCGG 1 cut(s) 48
MspR9I CCNGG 2 cut(s) 53, 97
MvaI CCWGG 2 cut(s) 53, 97
NmeAIII GCCGAG 1 cut(s) 108
PkrI GCNGC 1 cut(s) 123
Psp6I CCWGG 2 cut(s) 51, 95
PspFI CCCAGC 1 cut(s) 90
PspGI CCWGG 2 cut(s) 51, 95
PspPI GGNCC 2 cut(s) 45, 93
RseI CAYNNNNRTG 1 cut(s) 143
SatI GCNGC 1 cut(s) 122
Sau96I GGNCC 2 cut(s) 45, 93
ScrFI CCNGG 2 cut(s) 53, 97
SetI ASST 2 cut(s) 11, 101
SfaNI GCATC 2 cut(s) 58, 77
SfcI CTRYAG 2 cut(s) 77, 154
SinI GGWCC 1 cut(s) 45
SmiMI CAYNNNNRTG 1 cut(s) 143
Sse9I AATT 1 cut(s) 17
SsiI CCGC 1 cut(s) 122
StyD4I CCNGG 2 cut(s) 51, 95
TaaI ACNGT 2 cut(s) 37, 78
TasI AATT 1 cut(s) 17
TauI GCSGC 1 cut(s) 124
TscAI CASTG 2 cut(s) 67, 150
TspRI CASTG 2 cut(s) 67, 150
VpaK11BI GGWCC 1 cut(s) 45
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.