Rmu_co8130632.1_g000001

Cullin-associated NEDD8-dissociated protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8130632.1
Physical Location & Seq
Forward (+)
1 .. 629
629 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8130632.1_g000001.1.cds

Sequence Viewer

Length: 371 bp
gctttgcaaaacttctttgcttccttggtgtattctgcaaatacaagttttgatgccttgctagactctcttctatcaagtgctaaaccatctcctcagtctggtggggttgcaaaacaagctctatattcaatagctcaatgcgtggctgtcctttgtcttgctgctggtgatgagaaatgttcatctacagtgcaaatgcttaccgaaattctcaaacatgacagcagtacaaactcggctaagcagcatcttgcattgctatgtcttggggagattgggagaaggaaagatctaagctctcatgcccatattgagaatattgttatcgagtcatttcagtctcctttcgaggagattaagtctgcagc

Protein Analysis

124

Amino Acids

13.18

Weight (kDa)

5.73

Isoelectric Point (pI)

71.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 210
AfaI GTAC 1 cut(s) 232
AfiI CCNNNNNNNGG 1 cut(s) 101
AgsI TTSAA 1 cut(s) 132
AluBI AGCT 3 cut(s) 122, 137, 300
AluI AGCT 3 cut(s) 122, 137, 300
Alw26I GTCTC 1 cut(s) 348
ApeKI GCWGC 3 cut(s) 164, 247, 368
ApoI RAATTY 1 cut(s) 210
AsuHPI GGTGA 1 cut(s) 182
BbvI GCAGC 2 cut(s) 151, 259
BccI CCATC 1 cut(s) 97
BcoDI GTCTC 1 cut(s) 348
BfaI CTAG 1 cut(s) 62
BfmI CTRYAG 2 cut(s) 189, 366
BglII AGATCT 1 cut(s) 292
BisI GCNGC 3 cut(s) 165, 248, 369
BlpI GCTNAGC 1 cut(s) 243
BlsI GCNGC 3 cut(s) 166, 249, 370
BmsI GCATC 2 cut(s) 43, 259
Bpu1102I GCTNAGC 1 cut(s) 243
BsaJI CCNNGG 1 cut(s) 24
BsaXI ACNNNNNCTCC 1 cut(s) 347
Bsc4I CCNNNNNNNGG 1 cut(s) 101
Bse3DI GCAATG 1 cut(s) 257
BseDI CCNNGG 1 cut(s) 24
BseLI CCNNNNNNNGG 1 cut(s) 101
BseMI GCAATG 1 cut(s) 257
BseMII CTCAG 1 cut(s) 110
BseRI GAGGAG 2 cut(s) 84, 368
BseXI GCAGC 2 cut(s) 151, 259
BslI CCNNNNNNNGG 1 cut(s) 101
BsmAI GTCTC 1 cut(s) 348
Bsp143I GATC 1 cut(s) 292
Bsp1720I GCTNAGC 1 cut(s) 243
BspCNI CTCAG 1 cut(s) 109
BspMAI CTGCAG 1 cut(s) 370
BsrDI GCAATG 1 cut(s) 257
BssECI CCNNGG 1 cut(s) 24
BssMI GATC 1 cut(s) 292
BssT1I CCWWGG 1 cut(s) 24
Bst4CI ACNGT 1 cut(s) 193
Bst6I CTCTTC 1 cut(s) 75
BstDEI CTNAG 3 cut(s) 96, 243, 296
BstKTI GATC 1 cut(s) 295
BstMAI GTCTC 1 cut(s) 348
BstMBI GATC 1 cut(s) 292
BstMWI GCNNNNNNNGC 1 cut(s) 119
BstSFI CTRYAG 2 cut(s) 189, 366
BstV1I GCAGC 2 cut(s) 151, 259
BstX2I RGATCY 1 cut(s) 292
BstYI RGATCY 1 cut(s) 292
BtsIMutI CAGTG 1 cut(s) 198
Csp6I GTAC 1 cut(s) 231
CviAII CATG 2 cut(s) 221, 305
CviJI RGCY 5 cut(s) 122, 137, 149, 242, 300
CviKI_1 RGCY 5 cut(s) 122, 137, 149, 242, 300
CviQI GTAC 1 cut(s) 231
DdeI CTNAG 3 cut(s) 96, 243, 296
DpnI GATC 1 cut(s) 294
DpnII GATC 1 cut(s) 292
Eam1104I CTCTTC 1 cut(s) 75
EarI CTCTTC 1 cut(s) 75
Eco130I CCWWGG 1 cut(s) 24
EcoT14I CCWWGG 1 cut(s) 24
ErhI CCWWGG 1 cut(s) 24
FaeI CATG 2 cut(s) 224, 308
FaiI YATR 5 cut(s) 127, 222, 265, 306, 312
FatI CATG 2 cut(s) 220, 304
Fnu4HI GCNGC 3 cut(s) 165, 248, 369
Fsp4HI GCNGC 3 cut(s) 165, 248, 369
FspBI CTAG 1 cut(s) 62
GluI GCNGC 3 cut(s) 165, 248, 369
Hin1II CATG 2 cut(s) 224, 308
HinfI GANTC 2 cut(s) 65, 332
HphI GGTGA 1 cut(s) 182
HpyAV CCTTC 1 cut(s) 279
HpyCH4III ACNGT 1 cut(s) 193
HpyCH4V TGCA 6 cut(s) 7, 38, 113, 196, 257, 368
HpyF10VI GCNNNNNNNGC 1 cut(s) 119
HpyF3I CTNAG 3 cut(s) 96, 243, 296
Hsp92II CATG 2 cut(s) 224, 308
Kzo9I GATC 1 cut(s) 292
LpnPI CCDG 2 cut(s) 87, 153
Lsp1109I GCAGC 2 cut(s) 151, 259
LweI GCATC 2 cut(s) 43, 259
MaeI CTAG 1 cut(s) 62
MalI GATC 1 cut(s) 294
MboI GATC 1 cut(s) 292
MboII GAAGA 1 cut(s) 62
MflI RGATCY 1 cut(s) 292
MluCI AATT 1 cut(s) 210
MlyI GAGTC 2 cut(s) 59, 341
MnlI CCTC 2 cut(s) 105, 346
MseI TTAA 1 cut(s) 360
MslI CAYNNNNRTG 1 cut(s) 262
MwoI GCNNNNNNNGC 1 cut(s) 119
NdeII GATC 1 cut(s) 292
NlaIII CATG 2 cut(s) 224, 308
NmeAIII GCCGAG 1 cut(s) 218
PkrI GCNGC 3 cut(s) 166, 249, 370
PleI GAGTC 2 cut(s) 59, 340
PpsI GAGTC 2 cut(s) 59, 340
PstI CTGCAG 1 cut(s) 370
PsuI RGATCY 1 cut(s) 292
RsaI GTAC 1 cut(s) 232
RsaNI GTAC 1 cut(s) 231
RseI CAYNNNNRTG 1 cut(s) 262
SaqAI TTAA 1 cut(s) 360
SatI GCNGC 3 cut(s) 165, 248, 369
Sau3AI GATC 1 cut(s) 292
SchI GAGTC 2 cut(s) 59, 341
SetI ASST 3 cut(s) 124, 139, 302
SfaNI GCATC 2 cut(s) 43, 259
SfcI CTRYAG 2 cut(s) 189, 366
SmiMI CAYNNNNRTG 1 cut(s) 262
Sse9I AATT 1 cut(s) 210
SspI AATATT 1 cut(s) 322
SspMI CTAG 1 cut(s) 62
StyI CCWWGG 1 cut(s) 24
TaaI ACNGT 1 cut(s) 193
TaqI TCGA 2 cut(s) 330, 351
TasI AATT 1 cut(s) 210
TatI WGTACW 1 cut(s) 230
Tru1I TTAA 1 cut(s) 360
Tru9I TTAA 1 cut(s) 360
TscAI CASTG 1 cut(s) 198
TseI GCWGC 3 cut(s) 164, 247, 368
TspDTI ATGAA 1 cut(s) 174
TspRI CASTG 1 cut(s) 198
XapI RAATTY 1 cut(s) 210
XspI CTAG 1 cut(s) 62
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.