Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8135398.1

Orthogroup ID

OG0006553

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 578

Gene Structure 577 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8135398.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 326 bp

atggaagtcactggatttagtcctgcagtgagggaacaaatatacaaaatggcatcagtcaatctttgttctaatatcagtggtcaaattcttgcaagcctagtcatgagtccaccaaaggttggagatgaatcctatgaattgtatctttcagagaaagatggaattctgtcatccctaaaaaagcgtgcaaagacactagaggatgcgttgaacagcctggagggtgtgacatgcaacagagccgagggggcaatgtatctgtttcctcgcatagacctgcctcaaaaggcaatcaaagcagcagaggctgaaaagacagctcc

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000166 GO:0001666 GO:0003674 GO:0003824 GO:0004021 GO:0005488 GO:0005524 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005739 GO:0006082 GO:0006520 GO:0006522 GO:0006524 GO:0006807 GO:0006950 GO:0008144 GO:0008150 GO:0008152 GO:0008483 GO:0009056 GO:0009063 GO:0009078 GO:0009080 GO:0009507 GO:0009536 GO:0009628 GO:0009987 GO:0010035 GO:0010038 GO:0016054 GO:0016740 GO:0016769 GO:0017076 GO:0019481 GO:0019752 GO:0030554 GO:0032553 GO:0032555 GO:0032559 GO:0035639 GO:0036094 GO:0036293 GO:0042221 GO:0042851 GO:0042853 GO:0043167 GO:0043168 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043436 GO:0044237 GO:0044238 GO:0044248 GO:0044281 GO:0044282 GO:0044424 GO:0044444 GO:0044464 GO:0046395 GO:0046686 GO:0047635 GO:0050896 GO:0070482 GO:0071704 GO:0097159 GO:0097367 GO:1901265 GO:1901363 GO:1901564 GO:1901565 GO:1901575 GO:1901605 GO:1901606

KEGG Pathways

Metabolic & Signaling

ko00220 ko00250 ko00710 ko01100 ko01120 ko01200 ko01210 ko01230 map00220 map00250 map00710 map01100 map01120 map01200 map01210 map01230

Pfam Domains

Protein Families

Aminotran_1_2

Protein Analysis

109

Amino Acids

11.84

Weight (kDa)

5.47

Isoelectric Point (pI)

49.9

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006553)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G17290 AT1G72330 AT1G72330 AT1G72330
fragaria_vesca	FvH4_6g35810 FvH4_6g35810
malus_domestica	MD09G1173000.v1.1 MD17G1154300.v1.1
prunus_persica	Prupe.3G031100_v2.0.a1 Prupe.3G031100_v2.0.a1
pyrus_communis	pycom09g09040 pycom17g14700
rosa_chinensis	RchiOBHm_Chr2g0147841
rosa_laevigata	RLG00000020283
rosa_multiflora	Rmu_co8135398.1_g000001 Rmu_co8265871.1_g000001 Rmu_co8360303.1_g000001 Rmu_sc0000308.1_g000051 Rmu_sc0042380.1_g000001
rosa_roxburghii	Rroxscaffold_2G00099280
rosa_rugosa	Rorug02G0402300
rosa_samantha	Rh2AG459300 Rh2BG472600 Rh2CG446700 Rh2DG481600
rosa_wichuraiana	Rw2G037570

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	288
AccB7I	CCANNNNNTGG	1 cut(s)	122
AcsI	RAATTY	2 cut(s)	87, 165
AfiI	CCNNNNNNNGG	1 cut(s)	122
AgsI	TTSAA	1 cut(s)	214
AjnI	CCWGG	1 cut(s)	219
AluBI	AGCT	1 cut(s)	323
AluI	AGCT	1 cut(s)	323
AlwNI	CAGNNNCTG	1 cut(s)	311
ApeKI	GCWGC	1 cut(s)	302
ApoI	RAATTY	2 cut(s)	87, 165
BbvI	GCAGC	1 cut(s)	314
BccI	CCATC	1 cut(s)	155
BciT130I	CCWGG	1 cut(s)	221
BfaI	CTAG	2 cut(s)	101, 200
BfmI	CTRYAG	1 cut(s)	24
BfuAI	ACCTGC	1 cut(s)	288
BglI	GCCNNNNNGGC	1 cut(s)	251
BisI	GCNGC	1 cut(s)	303
BlsI	GCNGC	1 cut(s)	304
Bme1390I	CCNGG	1 cut(s)	221
BmrFI	CCNGG	1 cut(s)	221
BmsI	GCATC	2 cut(s)	62, 196
BpmI	CTGGAG	1 cut(s)	242
BsaJI	CCNNGG	1 cut(s)	246
Bsc4I	CCNNNNNNNGG	1 cut(s)	122
Bse1I	ACTGG	1 cut(s)	16
Bse3DI	GCAATG	1 cut(s)	261
BseBI	CCWGG	1 cut(s)	221
BseDI	CCNNGG	1 cut(s)	246
BseGI	GGATG	2 cut(s)	173, 211
BseLI	CCNNNNNNNGG	1 cut(s)	122
BseMI	GCAATG	1 cut(s)	261
BseNI	ACTGG	1 cut(s)	16
BseXI	GCAGC	1 cut(s)	314
BslI	CCNNNNNNNGG	1 cut(s)	122
BspHI	TCATGA	1 cut(s)	105
BspMAI	CTGCAG	1 cut(s)	28
BspMI	ACCTGC	1 cut(s)	288
BsrDI	GCAATG	1 cut(s)	261
BsrI	ACTGG	1 cut(s)	16
BssECI	CCNNGG	1 cut(s)	246
Bst2UI	CCWGG	1 cut(s)	221
BstC8I	GCNNGC	2 cut(s)	97, 189
BstF5I	GGATG	2 cut(s)	173, 211
BstMWI	GCNNNNNNNGC	3 cut(s)	251, 299, 308
BstNI	CCWGG	1 cut(s)	221
BstNSI	RCATGY	1 cut(s)	237
BstSCI	CCNGG	1 cut(s)	219
BstSFI	CTRYAG	1 cut(s)	24
BstV1I	GCAGC	1 cut(s)	314
BtsCI	GGATG	2 cut(s)	173, 211
BtsI	GCAGTG	1 cut(s)	33
BtsIMutI	CAGTG	3 cut(s)	9, 33, 85
BveI	ACCTGC	1 cut(s)	288
Cac8I	GCNNGC	2 cut(s)	97, 189
CaiI	CAGNNNCTG	1 cut(s)	311
CciI	TCATGA	1 cut(s)	105
CviAII	CATG	2 cut(s)	106, 234
CviJI	RGCY	5 cut(s)	99, 219, 245, 311, 323
CviKI_1	RGCY	5 cut(s)	99, 219, 245, 311, 323
EcoRI	GAATTC	1 cut(s)	165
EcoRII	CCWGG	1 cut(s)	219
FaeI	CATG	2 cut(s)	109, 237
FaiI	YATR	5 cut(s)	43, 107, 138, 235, 275
FatI	CATG	2 cut(s)	105, 233
Fnu4HI	GCNGC	1 cut(s)	303
FokI	GGATG	2 cut(s)	160, 218
Fsp4HI	GCNGC	1 cut(s)	303
FspBI	CTAG	2 cut(s)	101, 200
GluI	GCNGC	1 cut(s)	303
GsuI	CTGGAG	1 cut(s)	242
Hin1II	CATG	2 cut(s)	109, 237
HinfI	GANTC	2 cut(s)	109, 131
Hpy166II	GTNNAC	1 cut(s)	113
Hpy188I	TCNGA	1 cut(s)	154
Hpy188III	TCNNGA	1 cut(s)	106
Hpy8I	GTNNAC	1 cut(s)	113
HpyCH4V	TGCA	4 cut(s)	26, 95, 191, 237
HpyF10VI	GCNNNNNNNGC	3 cut(s)	251, 299, 308
Hsp92II	CATG	2 cut(s)	109, 237
LpnPI	CCDG	4 cut(s)	36, 206, 233, 293
Lsp1109I	GCAGC	1 cut(s)	314
LweI	GCATC	2 cut(s)	62, 196
MaeI	CTAG	2 cut(s)	101, 200
MaeIII	GTNAC	2 cut(s)	7, 229
MluCI	AATT	3 cut(s)	87, 140, 165
MlyI	GAGTC	1 cut(s)	118
MmeI	TCCRAC	1 cut(s)	103
MnlI	CCTC	7 cut(s)	24, 196, 217, 241, 279, 294, 301
MspR9I	CCNGG	1 cut(s)	221
MvaI	CCWGG	1 cut(s)	221
MwoI	GCNNNNNNNGC	3 cut(s)	251, 299, 308
NlaIII	CATG	2 cut(s)	109, 237
NmeAIII	GCCGAG	1 cut(s)	271
NmuCI	GTSAC	2 cut(s)	7, 229
NspI	RCATGY	1 cut(s)	237
PagI	TCATGA	1 cut(s)	105
PfeI	GAWTC	1 cut(s)	131
PflMI	CCANNNNNTGG	1 cut(s)	122
PkrI	GCNGC	1 cut(s)	304
PleI	GAGTC	1 cut(s)	117
PpsI	GAGTC	1 cut(s)	117
Psp6I	CCWGG	1 cut(s)	219
PspGI	CCWGG	1 cut(s)	219
PstI	CTGCAG	1 cut(s)	28
PstNI	CAGNNNCTG	1 cut(s)	311
SatI	GCNGC	1 cut(s)	303
SchI	GAGTC	1 cut(s)	118
ScrFI	CCNGG	1 cut(s)	221
SetI	ASST	3 cut(s)	123, 282, 325
SfaNI	GCATC	2 cut(s)	62, 196
SfcI	CTRYAG	1 cut(s)	24
Sse9I	AATT	3 cut(s)	87, 140, 165
SspMI	CTAG	2 cut(s)	101, 200
StyD4I	CCNGG	1 cut(s)	219
TasI	AATT	3 cut(s)	87, 140, 165
TfiI	GAWTC	1 cut(s)	131
TscAI	CASTG	3 cut(s)	16, 33, 85
TseFI	GTSAC	2 cut(s)	7, 229
TseI	GCWGC	1 cut(s)	302
Tsp45I	GTSAC	2 cut(s)	7, 229
TspDTI	ATGAA	2 cut(s)	144, 153
TspRI	CASTG	3 cut(s)	16, 33, 85
Van91I	CCANNNNNTGG	1 cut(s)	122
XapI	RAATTY	2 cut(s)	87, 165
XceI	RCATGY	1 cut(s)	237
XspI	CTAG	2 cut(s)	101, 200

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.