Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8360303.1

Orthogroup ID

OG0006553

Physical Location & Seq

Genomic Coordinates Reverse (-)

718 .. 1069

Gene Structure 352 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8360303.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 261 bp

atgtatctgtttcctcgcatagacctgcctcaaaaggcaatcaaagcagcagaggctgaaaagacagctccagatgcattctattgcaaacgtcttctgaatgccactggaattgttgttgttcctggttctggtttcgggcaggttcctggcacctggcattttagatgcacaatcttgccgcaagaggataaaattccagctatcgtcaaccgtctaacagagtttcacaaaaagttcatggacgagtttcgcgactag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0001666 GO:0006950 GO:0008150 GO:0009628 GO:0036293 GO:0050896 GO:0070482

KEGG Pathways

Metabolic & Signaling

ko00220 ko00250 ko00710 ko01100 ko01120 ko01200 ko01210 ko01230 map00220 map00250 map00710 map01100 map01120 map01200 map01210 map01230

Pfam Domains

Protein Families

Aminotran_1_2

Protein Analysis

86

Amino Acids

9.8

Weight (kDa)

8.66

Isoelectric Point (pI)

44.81

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006553)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G17290 AT1G72330 AT1G72330 AT1G72330
fragaria_vesca	FvH4_6g35810 FvH4_6g35810
malus_domestica	MD09G1173000.v1.1 MD17G1154300.v1.1
prunus_persica	Prupe.3G031100_v2.0.a1 Prupe.3G031100_v2.0.a1
pyrus_communis	pycom09g09040 pycom17g14700
rosa_chinensis	RchiOBHm_Chr2g0147841
rosa_laevigata	RLG00000020283
rosa_multiflora	Rmu_co8135398.1_g000001 Rmu_co8265871.1_g000001 Rmu_co8360303.1_g000001 Rmu_sc0000308.1_g000051 Rmu_sc0042380.1_g000001
rosa_roxburghii	Rroxscaffold_2G00099280
rosa_rugosa	Rorug02G0402300
rosa_samantha	Rh2AG459300 Rh2BG472600 Rh2CG446700 Rh2DG481600
rosa_wichuraiana	Rw2G037570

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	2 cut(s)	33, 133
AccB1I	GGYRCC	1 cut(s)	152
AccII	CGCG	1 cut(s)	255
AciI	CCGC	1 cut(s)	182
AcsI	RAATTY	1 cut(s)	195
AfiI	CCNNNNNNNGG	1 cut(s)	131
AjnI	CCWGG	3 cut(s)	124, 148, 155
AluBI	AGCT	2 cut(s)	68, 203
AluI	AGCT	2 cut(s)	68, 203
AlwNI	CAGNNNCTG	1 cut(s)	56
ApeKI	GCWGC	1 cut(s)	47
ApoI	RAATTY	1 cut(s)	195
BanI	GGYRCC	1 cut(s)	152
BbsI	GAAGAC	1 cut(s)	86
BbvI	GCAGC	1 cut(s)	59
BciT130I	CCWGG	3 cut(s)	126, 150, 157
BfaI	CTAG	1 cut(s)	259
BfuAI	ACCTGC	2 cut(s)	33, 133
BisI	GCNGC	2 cut(s)	48, 182
BlsI	GCNGC	2 cut(s)	49, 183
Bme1390I	CCNGG	3 cut(s)	126, 150, 157
BmiI	GGNNCC	2 cut(s)	147, 154
BmrFI	CCNGG	3 cut(s)	126, 150, 157
BmsI	GCATC	2 cut(s)	64, 158
BpiI	GAAGAC	1 cut(s)	86
BpmI	CTGGAG	1 cut(s)	54
Bsc4I	CCNNNNNNNGG	1 cut(s)	131
Bse1I	ACTGG	1 cut(s)	112
BseBI	CCWGG	3 cut(s)	126, 150, 157
BseLI	CCNNNNNNNGG	1 cut(s)	131
BseNI	ACTGG	1 cut(s)	112
BseXI	GCAGC	1 cut(s)	59
Bsh1236I	CGCG	1 cut(s)	255
BshNI	GGYRCC	1 cut(s)	152
BslI	CCNNNNNNNGG	1 cut(s)	131
BsmI	GAATGC	2 cut(s)	77, 106
Bsp68I	TCGCGA	1 cut(s)	255
BspACI	CCGC	1 cut(s)	182
BspFNI	CGCG	1 cut(s)	255
BspLI	GGNNCC	2 cut(s)	147, 154
BspMI	ACCTGC	2 cut(s)	33, 133
BspT107I	GGYRCC	1 cut(s)	152
BsrI	ACTGG	1 cut(s)	112
Bst2UI	CCWGG	3 cut(s)	126, 150, 157
Bst4CI	ACNGT	1 cut(s)	215
BstFNI	CGCG	1 cut(s)	255
BstMWI	GCNNNNNNNGC	3 cut(s)	44, 53, 74
BstNI	CCWGG	3 cut(s)	126, 150, 157
BstSCI	CCNGG	3 cut(s)	124, 148, 155
BstUI	CGCG	1 cut(s)	255
BstV1I	GCAGC	1 cut(s)	59
BstV2I	GAAGAC	1 cut(s)	86
BtsIMutI	CAGTG	1 cut(s)	105
BtuMI	TCGCGA	1 cut(s)	255
BveI	ACCTGC	2 cut(s)	33, 133
CaiI	CAGNNNCTG	1 cut(s)	56
CspCI	CAANNNNNGTGG	2 cut(s)	94, 129
CviAII	CATG	1 cut(s)	241
CviJI	RGCY	3 cut(s)	56, 68, 203
CviKI_1	RGCY	3 cut(s)	56, 68, 203
EcoRII	CCWGG	3 cut(s)	124, 148, 155
EcoT22I	ATGCAT	1 cut(s)	79
FaeI	CATG	1 cut(s)	244
FaiI	YATR	2 cut(s)	20, 242
FatI	CATG	1 cut(s)	240
Fnu4HI	GCNGC	2 cut(s)	48, 182
Fsp4HI	GCNGC	2 cut(s)	48, 182
FspBI	CTAG	1 cut(s)	259
GluI	GCNGC	2 cut(s)	48, 182
GsuI	CTGGAG	1 cut(s)	54
Hin1II	CATG	1 cut(s)	244
HincII	GTYRAC	1 cut(s)	211
HindII	GTYRAC	1 cut(s)	211
Hpy166II	GTNNAC	1 cut(s)	211
Hpy188I	TCNGA	1 cut(s)	99
Hpy188III	TCNNGA	2 cut(s)	71, 254
Hpy8I	GTNNAC	1 cut(s)	211
HpyCH4III	ACNGT	1 cut(s)	215
HpyCH4IV	ACGT	1 cut(s)	91
HpyCH4V	TGCA	3 cut(s)	77, 87, 171
HpyF10VI	GCNNNNNNNGC	3 cut(s)	44, 53, 74
HpySE526I	ACGT	1 cut(s)	91
Hsp92II	CATG	1 cut(s)	244
LmnI	GCTCC	1 cut(s)	73
Lsp1109I	GCAGC	1 cut(s)	59
LweI	GCATC	2 cut(s)	64, 158
MaeI	CTAG	1 cut(s)	259
MaeII	ACGT	1 cut(s)	91
MboII	GAAGA	1 cut(s)	86
MluCI	AATT	2 cut(s)	111, 195
MnlI	CCTC	4 cut(s)	24, 39, 46, 181
Mph1103I	ATGCAT	1 cut(s)	79
MspR9I	CCNGG	3 cut(s)	126, 150, 157
Mva1269I	GAATGC	2 cut(s)	77, 106
MvaI	CCWGG	3 cut(s)	126, 150, 157
MvnI	CGCG	1 cut(s)	255
MwoI	GCNNNNNNNGC	3 cut(s)	44, 53, 74
NlaIII	CATG	1 cut(s)	244
NlaIV	GGNNCC	2 cut(s)	147, 154
NruI	TCGCGA	1 cut(s)	255
NsiI	ATGCAT	1 cut(s)	79
PcsI	WCGNNNNNNNCGW	1 cut(s)	252
PctI	GAATGC	2 cut(s)	77, 106
PkrI	GCNGC	2 cut(s)	49, 183
Psp6I	CCWGG	3 cut(s)	124, 148, 155
PspGI	CCWGG	3 cut(s)	124, 148, 155
PspN4I	GGNNCC	2 cut(s)	147, 154
PstNI	CAGNNNCTG	1 cut(s)	56
RruI	TCGCGA	1 cut(s)	255
SatI	GCNGC	2 cut(s)	48, 182
ScrFI	CCNGG	3 cut(s)	126, 150, 157
SetI	ASST	6 cut(s)	27, 70, 94, 147, 158, 205
SfaNI	GCATC	2 cut(s)	64, 158
Sse9I	AATT	2 cut(s)	111, 195
SsiI	CCGC	1 cut(s)	182
SspMI	CTAG	1 cut(s)	259
StyD4I	CCNGG	3 cut(s)	124, 148, 155
TaaI	ACNGT	1 cut(s)	215
TaiI	ACGT	1 cut(s)	94
TasI	AATT	2 cut(s)	111, 195
TauI	GCSGC	1 cut(s)	184
TscAI	CASTG	1 cut(s)	112
TseI	GCWGC	1 cut(s)	47
TspDTI	ATGAA	1 cut(s)	229
TspRI	CASTG	1 cut(s)	112
XapI	RAATTY	1 cut(s)	195
XspI	CTAG	1 cut(s)	259
Zsp2I	ATGCAT	1 cut(s)	79

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.