Rmu_co8148590.1_g000001

phosphatidylinositol 4-phosphate 5-kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8148590.1
Physical Location & Seq
Reverse (-)
1 .. 355
355 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8148590.1_g000001.1.cds

Sequence Viewer

Length: 266 bp
atgggaagttcgagatcaaataggtccagaaattccagagcacagtcatcagcacaggaatgcttcaatgttcttttattctttggaatagtagatatttgtcagaattacaatatgagaaaacgccttgagcatgcttgcaagtccattaaatatgactcaaagtccattgcaactgtgaaccccaaagtttattcttctcgctttcaagagtttatgagcgaagtgtttctaccagaagtgtcggacgacttttctgatagccg

Protein Analysis

89

Amino Acids

10.27

Weight (kDa)

8.93

Isoelectric Point (pI)

69.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 31
AgsI TTSAA 2 cut(s) 67, 209
AhdI GACNNNNNGTC 1 cut(s) 163
Alw21I GWGCWC 1 cut(s) 43
ApoI RAATTY 1 cut(s) 31
Asp700I GAANNNNTTC 1 cut(s) 228
AspS9I GGNCC 1 cut(s) 24
AvaII GGWCC 1 cut(s) 24
BarI GAAGNNNNNNTAC 2 cut(s) 216, 248
Bbv12I GWGCWC 1 cut(s) 43
Bme18I GGWCC 1 cut(s) 24
BmeRI GACNNNNNGTC 1 cut(s) 163
BmgT120I GGNCC 1 cut(s) 24
BpuEI CTTGAG 1 cut(s) 149
Bse3DI GCAATG 1 cut(s) 168
BseMI GCAATG 1 cut(s) 168
BsiHKAI GWGCWC 1 cut(s) 43
BsmI GAATGC 1 cut(s) 65
Bsp1286I GDGCHC 1 cut(s) 43
Bsp143I GATC 1 cut(s) 14
BsrDI GCAATG 1 cut(s) 168
BssMI GATC 1 cut(s) 14
Bst4CI ACNGT 2 cut(s) 45, 178
BstC8I GCNNGC 2 cut(s) 135, 139
BstKTI GATC 1 cut(s) 17
BstMBI GATC 1 cut(s) 14
BstNSI RCATGY 1 cut(s) 137
Cac8I GCNNGC 2 cut(s) 135, 139
Cfr13I GGNCC 1 cut(s) 24
CviAII CATG 1 cut(s) 134
CviJI RGCY 1 cut(s) 264
CviKI_1 RGCY 1 cut(s) 264
DpnI GATC 1 cut(s) 16
DpnII GATC 1 cut(s) 14
DriI GACNNNNNGTC 1 cut(s) 163
Eam1105I GACNNNNNGTC 1 cut(s) 163
Eco47I GGWCC 1 cut(s) 24
FaeI CATG 1 cut(s) 137
FaiI YATR 4 cut(s) 116, 135, 156, 218
FatI CATG 1 cut(s) 133
Hin1II CATG 1 cut(s) 137
HinfI GANTC 1 cut(s) 158
Hpy166II GTNNAC 1 cut(s) 181
Hpy188I TCNGA 3 cut(s) 105, 247, 259
Hpy188III TCNNGA 4 cut(s) 12, 27, 36, 209
Hpy8I GTNNAC 1 cut(s) 181
HpyCH4III ACNGT 2 cut(s) 45, 178
HpyCH4V TGCA 2 cut(s) 141, 173
Hsp92II CATG 1 cut(s) 137
Kzo9I GATC 1 cut(s) 14
LpnPI CCDG 4 cut(s) 40, 41, 49, 249
MalI GATC 1 cut(s) 16
MboI GATC 1 cut(s) 14
MboII GAAGA 1 cut(s) 189
MhlI GDGCHC 1 cut(s) 43
MluCI AATT 2 cut(s) 31, 106
MlyI GAGTC 1 cut(s) 152
MmeI TCCRAC 1 cut(s) 225
MroXI GAANNNNTTC 1 cut(s) 228
MseI TTAA 1 cut(s) 150
MslI CAYNNNNRTG 1 cut(s) 58
Mva1269I GAATGC 1 cut(s) 65
NdeII GATC 1 cut(s) 14
NlaIII CATG 1 cut(s) 137
NspI RCATGY 1 cut(s) 137
PaeI GCATGC 1 cut(s) 137
PctI GAATGC 1 cut(s) 65
PdmI GAANNNNTTC 1 cut(s) 228
PleI GAGTC 1 cut(s) 152
PpsI GAGTC 1 cut(s) 152
PspPI GGNCC 1 cut(s) 24
RseI CAYNNNNRTG 1 cut(s) 58
SaqAI TTAA 1 cut(s) 150
Sau3AI GATC 1 cut(s) 14
Sau96I GGNCC 1 cut(s) 24
SchI GAGTC 1 cut(s) 152
SduI GDGCHC 1 cut(s) 43
SetI ASST 1 cut(s) 26
SinI GGWCC 1 cut(s) 24
SmiMI CAYNNNNRTG 1 cut(s) 58
SmlI CTYRAG 1 cut(s) 128
SmoI CTYRAG 1 cut(s) 128
SphI GCATGC 1 cut(s) 137
Sse9I AATT 2 cut(s) 31, 106
TaaI ACNGT 2 cut(s) 45, 178
TaqI TCGA 1 cut(s) 11
TasI AATT 2 cut(s) 31, 106
Tru1I TTAA 1 cut(s) 150
Tru9I TTAA 1 cut(s) 150
VpaK11BI GGWCC 1 cut(s) 24
XapI RAATTY 1 cut(s) 31
XceI RCATGY 1 cut(s) 137
XmnI GAANNNNTTC 1 cut(s) 228
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.