Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0008220.1

Orthogroup ID

OG0006578

Physical Location & Seq

Genomic Coordinates Forward (+)

38732 .. 41222

Gene Structure 2491 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0008220.1_g000008.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 774 bp

atgcttcccaactactacgaccatcttatgaagtatggatcctcactactagccaaactgtatggacttcatgttgtcaggccagcaggaggtgttaaggtttactttgttgtttttggaaacgtaatcccgtcagatatttgcatatttgagcattatgacctcaaaggctcttcaaaaggtcgagcagagaacaaagtcattattcaggagagacccgtacataaggatatggattttgattttagcttttacctggatccattggttcgagaccggctcttagcgcaaatcaagactgactgcgagtttttggaatctgaaggcgtcatggattatagtttgtttcttgctatagaaatagaatctccacatcaaggtggttctcaagattccttttcacttcctgggcctggttttagatttggtgcaagcctgccagcacgtgctgtccgggccttcaagaaagaaatgggaagttcgagatcaaataggtccagaaattccagagcacagtcatcagcacaggaatgcttcaatgttcttttattctttggaatagtagatatttgtcagaattacaatatgagaaaacgccttgagcatgcttgcaagtccattaaatatgactcaaagtccattgcaactgtgaaccccaaagtttattcttctcgctttcaagagtttatgagcgaagtgtttctaccagaagtgtcggacgacttttctgatagccggtacattctttctctacctattagtctttatctgtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0006629 GO:0006644 GO:0006650 GO:0006793 GO:0006796 GO:0008150 GO:0008152 GO:0009987 GO:0016301 GO:0016307 GO:0016308 GO:0016310 GO:0016740 GO:0016772 GO:0016773 GO:0019637 GO:0030258 GO:0044237 GO:0044238 GO:0044255 GO:0046486 GO:0046488 GO:0046834 GO:0046854 GO:0071704

KEGG Pathways

Metabolic & Signaling

ko00562 ko01100 ko04011 ko04070 ko04072 ko04139 ko04144 ko04666 ko04810 ko05231 map00562 map01100 map04011 map04070 map04072 map04139 map04144 map04666 map04810 map05231

Pfam Domains

Protein Families

PIP5K

Protein Analysis

257

Amino Acids

29.25

Weight (kDa)

7.64

Isoelectric Point (pI)

53.82

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006578)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G01460 AT4G01190 AT4G01190 AT4G01190
fragaria_vesca	FvH4_7g15740 FvH4_7g15740 FvH4_7g15740 FvH4_7g15740
malus_domestica	MD01G1073900.v1.1 MD07G1142600.v1.1
prunus_persica	Prupe.2G182000_v2.0.a1 Prupe.2G182000_v2.0.a1
pyrus_communis	pycom01g10310
rosa_chinensis	RchiOBHm_Chr1g0358451
rosa_laevigata	RLG00000027957
rosa_multiflora	Rmu_co8148590.1_g000001 Rmu_sc0008220.1_g000008
rosa_roxburghii	Rroxscaffold_4G00297910
rosa_rugosa	Rorug01G0262000 Rorug01G0262100 Rorug01G0262200
rosa_samantha	Rh1AG276600 Rh1BG243100 Rh1CG260200 Rh1DG271400
rosa_wichuraiana	Rw1G024600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	4 cut(s)	33, 46, 254, 267
AcsI	RAATTY	1 cut(s)	502
AcuI	CTGAAG	1 cut(s)	342
AcvI	CACGTG	1 cut(s)	446
AcyI	GRCGYC	1 cut(s)	327
AfaI	GTAC	2 cut(s)	222, 740
AfiI	CCNNNNNNNGG	3 cut(s)	89, 377, 413
AgsI	TTSAA	4 cut(s)	177, 463, 538, 680
AhdI	GACNNNNNGTC	1 cut(s)	634
AjnI	CCWGG	3 cut(s)	255, 406, 412
AluBI	AGCT	1 cut(s)	249
AluI	AGCT	1 cut(s)	249
Alw21I	GWGCWC	1 cut(s)	514
Alw26I	GTCTC	2 cut(s)	208, 267
AlwI	GGATC	4 cut(s)	33, 46, 254, 267
AoxI	GGCC	3 cut(s)	80, 410, 456
ApoI	RAATTY	1 cut(s)	502
Asp700I	GAANNNNTTC	1 cut(s)	699
AspLEI	GCGC	1 cut(s)	289
AspS9I	GGNCC	3 cut(s)	410, 456, 495
AsuC2I	CCSGG	1 cut(s)	455
AvaII	GGWCC	1 cut(s)	495
BamHI	GGATCC	2 cut(s)	38, 259
BarI	GAAGNNNNNNTAC	2 cut(s)	687, 719
BbrPI	CACGTG	1 cut(s)	446
Bbv12I	GWGCWC	1 cut(s)	514
BccI	CCATC	1 cut(s)	30
BciT130I	CCWGG	3 cut(s)	257, 408, 414
BcnI	CCSGG	1 cut(s)	455
BcoDI	GTCTC	2 cut(s)	208, 267
BfaI	CTAG	1 cut(s)	50
BfmI	CTRYAG	1 cut(s)	354
Bme1390I	CCNGG	4 cut(s)	257, 408, 414, 455
Bme18I	GGWCC	1 cut(s)	495
BmeRI	GACNNNNNGTC	1 cut(s)	634
BmgT120I	GGNCC	3 cut(s)	410, 456, 495
BmiI	GGNNCC	2 cut(s)	40, 261
BmrFI	CCNGG	4 cut(s)	257, 408, 414, 455
BplI	GAGNNNNNCTC	2 cut(s)	264, 296
BpuEI	CTTGAG	2 cut(s)	372, 620
BpuMI	CCSGG	1 cut(s)	455
BsaAI	YACGTR	1 cut(s)	446
BsaHI	GRCGYC	1 cut(s)	327
BsaI	GGTCTC	2 cut(s)	208, 267
BsaJI	CCNNGG	1 cut(s)	407
Bsc4I	CCNNNNNNNGG	3 cut(s)	89, 377, 413
Bse118I	RCCGGY	2 cut(s)	276, 735
Bse3DI	GCAATG	1 cut(s)	639
BseBI	CCWGG	3 cut(s)	257, 408, 414
BseDI	CCNNGG	1 cut(s)	407
BseLI	CCNNNNNNNGG	3 cut(s)	89, 377, 413
BseMI	GCAATG	1 cut(s)	639
BshFI	GGCC	3 cut(s)	82, 412, 458
BsiHKAI	GWGCWC	1 cut(s)	514
BsiSI	CCGG	3 cut(s)	277, 454, 736
BslI	CCNNNNNNNGG	3 cut(s)	89, 377, 413
BsmAI	GTCTC	2 cut(s)	208, 267
BsmI	GAATGC	1 cut(s)	536
BsnI	GGCC	3 cut(s)	82, 412, 458
Bso31I	GGTCTC	2 cut(s)	208, 267
Bsp1286I	GDGCHC	1 cut(s)	514
Bsp143I	GATC	3 cut(s)	38, 259, 485
BspANI	GGCC	3 cut(s)	82, 412, 458
BspLI	GGNNCC	2 cut(s)	40, 261
BspPI	GGATC	4 cut(s)	33, 46, 254, 267
BspQI	GCTCTTC	1 cut(s)	178
BspTNI	GGTCTC	2 cut(s)	208, 267
BsrDI	GCAATG	1 cut(s)	639
BsrFI	RCCGGY	2 cut(s)	276, 735
BssAI	RCCGGY	2 cut(s)	276, 735
BssECI	CCNNGG	1 cut(s)	407
BssMI	GATC	3 cut(s)	38, 259, 485
BssNI	GRCGYC	1 cut(s)	327
Bst2UI	CCWGG	3 cut(s)	257, 408, 414
Bst4CI	ACNGT	3 cut(s)	60, 516, 649
Bst6I	CTCTTC	1 cut(s)	178
BstACI	GRCGYC	1 cut(s)	327
BstBAI	YACGTR	1 cut(s)	446
BstC8I	GCNNGC	6 cut(s)	84, 433, 437, 441, 606, 610
BstDEI	CTNAG	1 cut(s)	283
BstHHI	GCGC	1 cut(s)	289
BstKTI	GATC	3 cut(s)	41, 262, 488
BstMAI	GTCTC	2 cut(s)	208, 267
BstMBI	GATC	3 cut(s)	38, 259, 485
BstMWI	GCNNNNNNNGC	2 cut(s)	286, 455
BstNI	CCWGG	3 cut(s)	257, 408, 414
BstNSI	RCATGY	1 cut(s)	608
BstSCI	CCNGG	4 cut(s)	255, 406, 412, 453
BstSFI	CTRYAG	1 cut(s)	354
BstX2I	RGATCY	2 cut(s)	38, 259
BstYI	RGATCY	2 cut(s)	38, 259
BsuRI	GGCC	3 cut(s)	82, 412, 458
Cac8I	GCNNGC	6 cut(s)	84, 433, 437, 441, 606, 610
CfoI	GCGC	1 cut(s)	289
Cfr10I	RCCGGY	2 cut(s)	276, 735
Cfr13I	GGNCC	3 cut(s)	410, 456, 495
CseI	GACGC	1 cut(s)	316
Csp6I	GTAC	2 cut(s)	221, 739
CviAII	CATG	3 cut(s)	71, 331, 605
CviJI	RGCY	9 cut(s)	53, 82, 171, 249, 280, 412, 435, 458, 735
CviKI_1	RGCY	9 cut(s)	53, 82, 171, 249, 280, 412, 435, 458, 735
CviQI	GTAC	2 cut(s)	221, 739
DdeI	CTNAG	1 cut(s)	283
DpnI	GATC	3 cut(s)	40, 261, 487
DpnII	GATC	3 cut(s)	38, 259, 485
DriI	GACNNNNNGTC	1 cut(s)	634
Eam1104I	CTCTTC	1 cut(s)	178
Eam1105I	GACNNNNNGTC	1 cut(s)	634
EarI	CTCTTC	1 cut(s)	178
Eco31I	GGTCTC	2 cut(s)	208, 267
Eco47I	GGWCC	1 cut(s)	495
Eco57I	CTGAAG	1 cut(s)	342
Eco72I	CACGTG	1 cut(s)	446
EcoRII	CCWGG	3 cut(s)	255, 406, 412
FaeI	CATG	3 cut(s)	74, 334, 608
FalI	AAGNNNNNCTT	2 cut(s)	89, 121
FatI	CATG	3 cut(s)	70, 330, 604
FspBI	CTAG	1 cut(s)	50
GlaI	GCGC	1 cut(s)	288
HaeIII	GGCC	3 cut(s)	82, 412, 458
HapII	CCGG	3 cut(s)	277, 454, 736
HgaI	GACGC	1 cut(s)	316
HhaI	GCGC	1 cut(s)	289
Hin1I	GRCGYC	1 cut(s)	327
Hin1II	CATG	3 cut(s)	74, 334, 608
Hin6I	GCGC	1 cut(s)	287
HinP1I	GCGC	1 cut(s)	287
HinfI	GANTC	4 cut(s)	317, 365, 392, 629
HpaII	CCGG	3 cut(s)	277, 454, 736
Hpy166II	GTNNAC	2 cut(s)	103, 652
Hpy188I	TCNGA	5 cut(s)	136, 322, 576, 718, 730
Hpy188III	TCNNGA	9 cut(s)	209, 272, 295, 389, 463, 483, 498, 507, 680
Hpy8I	GTNNAC	2 cut(s)	103, 652
HpyAV	CCTTC	2 cut(s)	317, 469
HpyCH4III	ACNGT	3 cut(s)	60, 516, 649
HpyCH4IV	ACGT	2 cut(s)	123, 445
HpyCH4V	TGCA	4 cut(s)	144, 431, 612, 644
HpyF10VI	GCNNNNNNNGC	2 cut(s)	286, 455
HpyF3I	CTNAG	1 cut(s)	283
HpySE526I	ACGT	2 cut(s)	123, 445
Hsp92I	GRCGYC	1 cut(s)	327
Hsp92II	CATG	3 cut(s)	74, 334, 608
HspAI	GCGC	1 cut(s)	287
Kzo9I	GATC	3 cut(s)	38, 259, 485
LguI	GCTCTTC	1 cut(s)	178
MaeI	CTAG	1 cut(s)	50
MaeII	ACGT	2 cut(s)	123, 445
MalI	GATC	3 cut(s)	40, 261, 487
MboI	GATC	3 cut(s)	38, 259, 485
MboII	GAAGA	2 cut(s)	165, 660
MflI	RGATCY	2 cut(s)	38, 259
MhlI	GDGCHC	1 cut(s)	514
MluCI	AATT	2 cut(s)	502, 577
MlyI	GAGTC	1 cut(s)	623
MmeI	TCCRAC	1 cut(s)	696
MnlI	CCTC	3 cut(s)	52, 83, 173
MroXI	GAANNNNTTC	1 cut(s)	699
MseI	TTAA	2 cut(s)	96, 621
MslI	CAYNNNNRTG	2 cut(s)	378, 529
MspI	CCGG	3 cut(s)	277, 454, 736
MspR9I	CCNGG	4 cut(s)	257, 408, 414, 455
Mva1269I	GAATGC	1 cut(s)	536
MvaI	CCWGG	3 cut(s)	257, 408, 414
MwoI	GCNNNNNNNGC	2 cut(s)	286, 455
NciI	CCSGG	1 cut(s)	455
NdeII	GATC	3 cut(s)	38, 259, 485
NlaIII	CATG	3 cut(s)	74, 334, 608
NlaIV	GGNNCC	2 cut(s)	40, 261
NspI	RCATGY	1 cut(s)	608
PaeI	GCATGC	1 cut(s)	608
PciSI	GCTCTTC	1 cut(s)	178
PctI	GAATGC	1 cut(s)	536
PdmI	GAANNNNTTC	1 cut(s)	699
PfeI	GAWTC	3 cut(s)	317, 365, 392
PleI	GAGTC	1 cut(s)	623
PmaCI	CACGTG	1 cut(s)	446
PmlI	CACGTG	1 cut(s)	446
PpsI	GAGTC	1 cut(s)	623
Ppu21I	YACGTR	1 cut(s)	446
Psp6I	CCWGG	3 cut(s)	255, 406, 412
PspCI	CACGTG	1 cut(s)	446
PspGI	CCWGG	3 cut(s)	255, 406, 412
PspN4I	GGNNCC	2 cut(s)	40, 261
PspPI	GGNCC	3 cut(s)	410, 456, 495
PsuI	RGATCY	2 cut(s)	38, 259
RsaI	GTAC	2 cut(s)	222, 740
RsaNI	GTAC	2 cut(s)	221, 739
RseI	CAYNNNNRTG	2 cut(s)	378, 529
SapI	GCTCTTC	1 cut(s)	178
SaqAI	TTAA	2 cut(s)	96, 621
Sau3AI	GATC	3 cut(s)	38, 259, 485
Sau96I	GGNCC	3 cut(s)	410, 456, 495
SchI	GAGTC	1 cut(s)	623
ScrFI	CCNGG	4 cut(s)	257, 408, 414, 455
SduI	GDGCHC	1 cut(s)	514
SfcI	CTRYAG	1 cut(s)	354
SinI	GGWCC	1 cut(s)	495
SmiMI	CAYNNNNRTG	2 cut(s)	378, 529
SmlI	CTYRAG	2 cut(s)	387, 599
SmoI	CTYRAG	2 cut(s)	387, 599
SphI	GCATGC	1 cut(s)	608
Sse9I	AATT	2 cut(s)	502, 577
SspMI	CTAG	1 cut(s)	50
StyD4I	CCNGG	4 cut(s)	255, 406, 412, 453
TaaI	ACNGT	3 cut(s)	60, 516, 649
TaiI	ACGT	2 cut(s)	126, 448
TaqI	TCGA	3 cut(s)	184, 271, 482
TasI	AATT	2 cut(s)	502, 577
TfiI	GAWTC	3 cut(s)	317, 365, 392
Tru1I	TTAA	2 cut(s)	96, 621
Tru9I	TTAA	2 cut(s)	96, 621
TspDTI	ATGAA	2 cut(s)	44, 59
VpaK11BI	GGWCC	1 cut(s)	495
XapI	RAATTY	1 cut(s)	502
XceI	RCATGY	1 cut(s)	608
XmnI	GAANNNNTTC	1 cut(s)	699
XspI	CTAG	1 cut(s)	50

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.