Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8219316.1

Orthogroup ID

OG0009444

Physical Location & Seq

Genomic Coordinates Forward (+)

113 .. 638

Gene Structure 526 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8219316.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 360 bp

atgcagactggcttggaaaagaacttgtttggaaatcatccagtttcattgtcatcgacagagtcccgtagtccgccacctgcattttcctcagatgcagggcaggggaatattgcaacctcatcttcattagcaaaagatgaaactggagcagggtctgctatacttcaagtgacagacatagtggagatagaaggtcctagttcagcagggaattttataaaaagcacaagtccagttggtcctggtgctacaacacgaaagggtgcattccaggttgagcggcaaaattctgaaatctcatattatgcagatgatgaagatgggaatcgtaaaaagtattcacggaggggtaagtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

119

Amino Acids

12.5

Weight (kDa)

5.8

Isoelectric Point (pI)

57.41

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009444)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G14835 AT2G14835
fragaria_vesca	FvH4_2g04180
malus_domestica	MD05G1098600.v1.1 MD10G1104500.v1.1
prunus_persica	Prupe.8G143400_v2.0.a1 Prupe.8G143400_v2.0.a1
pyrus_communis	pycom10g09000
rosa_chinensis	RchiOBHm_Chr6g0253531
rosa_laevigata	RLG00000015003
rosa_multiflora	Rmu_co8219316.1_g000001 Rmu_sc0020812.1_g000003 Rmu_ssc0000079.1_g000001
rosa_roxburghii	Rroxscaffold_7G00211800
rosa_rugosa	Rorug05G0544800 Rorug05G0544900 Rorug05G0545000
rosa_samantha	Rh6AG060000 Rh6BG054000 Rh6CG053700 Rh6DG051300
rosa_wichuraiana	Rw6G005360

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	221
AarI	CACCTGC	1 cut(s)	88
Acc36I	ACCTGC	1 cut(s)	88
AccBSI	CCGCTC	1 cut(s)	283
AciI	CCGC	2 cut(s)	74, 283
AcsI	RAATTY	2 cut(s)	214, 289
AgsI	TTSAA	1 cut(s)	170
AjnI	CCWGG	2 cut(s)	244, 273
AlwNI	CAGNNNCTG	1 cut(s)	158
ApoI	RAATTY	2 cut(s)	214, 289
AspS9I	GGNCC	2 cut(s)	197, 242
AvaII	GGWCC	2 cut(s)	197, 242
BccI	CCATC	1 cut(s)	317
BciT130I	CCWGG	2 cut(s)	246, 275
BfaI	CTAG	1 cut(s)	201
BfuAI	ACCTGC	1 cut(s)	88
BisI	GCNGC	1 cut(s)	284
BlsI	GCNGC	1 cut(s)	285
Bme1390I	CCNGG	2 cut(s)	246, 275
Bme18I	GGWCC	2 cut(s)	197, 242
BmgT120I	GGNCC	2 cut(s)	197, 242
BmrFI	CCNGG	2 cut(s)	246, 275
BmsI	GCATC	1 cut(s)	85
BpmI	CTGGAG	1 cut(s)	168
BsaBI	GATNNNNATC	1 cut(s)	327
Bse1I	ACTGG	4 cut(s)	13, 41, 151, 236
Bse8I	GATNNNNATC	1 cut(s)	327
BseBI	CCWGG	2 cut(s)	246, 275
BseGI	GGATG	1 cut(s)	37
BseJI	GATNNNNATC	1 cut(s)	327
BseMII	CTCAG	1 cut(s)	105
BseNI	ACTGG	4 cut(s)	13, 41, 151, 236
BslFI	GGGAC	1 cut(s)	49
BsmFI	GGGAC	1 cut(s)	49
BsmI	GAATGC	1 cut(s)	269
BspACI	CCGC	2 cut(s)	74, 283
BspCNI	CTCAG	1 cut(s)	104
BspMI	ACCTGC	1 cut(s)	88
BsrBI	CCGCTC	1 cut(s)	283
BsrI	ACTGG	4 cut(s)	13, 41, 151, 236
Bst2UI	CCWGG	2 cut(s)	246, 275
BstAPI	GCANNNNNTGC	1 cut(s)	158
BstDEI	CTNAG	1 cut(s)	91
BstF5I	GGATG	1 cut(s)	37
BstMWI	GCNNNNNNNGC	1 cut(s)	158
BstNI	CCWGG	2 cut(s)	246, 275
BstSCI	CCNGG	2 cut(s)	244, 273
BtsCI	GGATG	1 cut(s)	37
BveI	ACCTGC	1 cut(s)	88
CaiI	CAGNNNCTG	1 cut(s)	158
Cfr13I	GGNCC	2 cut(s)	197, 242
CviJI	RGCY	1 cut(s)	12
CviKI_1	RGCY	1 cut(s)	12
DdeI	CTNAG	1 cut(s)	91
EciI	GGCGGA	1 cut(s)	63
Eco47I	GGWCC	2 cut(s)	197, 242
EcoO109I	RGGNCCY	1 cut(s)	197
EcoRII	CCWGG	2 cut(s)	244, 273
FaiI	YATR	5 cut(s)	164, 182, 221, 304, 309
FaqI	GGGAC	1 cut(s)	49
Fnu4HI	GCNGC	1 cut(s)	284
FokI	GGATG	1 cut(s)	24
Fsp4HI	GCNGC	1 cut(s)	284
FspBI	CTAG	1 cut(s)	201
GluI	GCNGC	1 cut(s)	284
GsuI	CTGGAG	1 cut(s)	168
HinfI	GANTC	2 cut(s)	62, 328
Hpy188I	TCNGA	2 cut(s)	94, 295
HpyAV	CCTTC	1 cut(s)	188
HpyCH4V	TGCA	6 cut(s)	4, 83, 98, 116, 269, 311
HpyF10VI	GCNNNNNNNGC	1 cut(s)	158
HpyF3I	CTNAG	1 cut(s)	91
LmnI	GCTCC	1 cut(s)	149
LweI	GCATC	1 cut(s)	85
MaeI	CTAG	1 cut(s)	201
MaeIII	GTNAC	1 cut(s)	172
MbiI	CCGCTC	1 cut(s)	283
MboII	GAAGA	2 cut(s)	117, 332
MluCI	AATT	2 cut(s)	214, 289
MlyI	GAGTC	1 cut(s)	71
MnlI	CCTC	3 cut(s)	100, 130, 342
MspR9I	CCNGG	2 cut(s)	246, 275
Mva1269I	GAATGC	1 cut(s)	269
MvaI	CCWGG	2 cut(s)	246, 275
MwoI	GCNNNNNNNGC	1 cut(s)	158
NmuCI	GTSAC	1 cut(s)	172
PaqCI	CACCTGC	1 cut(s)	88
PctI	GAATGC	1 cut(s)	269
PfeI	GAWTC	1 cut(s)	328
PflFI	GACNNNGTC	1 cut(s)	61
PkrI	GCNGC	1 cut(s)	285
PleI	GAGTC	1 cut(s)	70
PpsI	GAGTC	1 cut(s)	70
PpuMI	RGGWCCY	1 cut(s)	197
PsiI	TTATAA	1 cut(s)	221
Psp5II	RGGWCCY	1 cut(s)	197
Psp6I	CCWGG	2 cut(s)	244, 273
PspGI	CCWGG	2 cut(s)	244, 273
PspPI	GGNCC	2 cut(s)	197, 242
PspPPI	RGGWCCY	1 cut(s)	197
PstNI	CAGNNNCTG	1 cut(s)	158
PsyI	GACNNNGTC	1 cut(s)	61
SatI	GCNGC	1 cut(s)	284
Sau96I	GGNCC	2 cut(s)	197, 242
SchI	GAGTC	1 cut(s)	71
ScrFI	CCNGG	2 cut(s)	246, 275
SetI	ASST	4 cut(s)	82, 122, 199, 279
SfaNI	GCATC	1 cut(s)	85
SinI	GGWCC	2 cut(s)	197, 242
Sse9I	AATT	2 cut(s)	214, 289
SsiI	CCGC	2 cut(s)	74, 283
SspI	AATATT	1 cut(s)	112
SspMI	CTAG	1 cut(s)	201
StyD4I	CCNGG	2 cut(s)	244, 273
TaqI	TCGA	1 cut(s)	56
TasI	AATT	2 cut(s)	214, 289
TauI	GCSGC	1 cut(s)	286
TfiI	GAWTC	1 cut(s)	328
TseFI	GTSAC	1 cut(s)	172
Tsp45I	GTSAC	1 cut(s)	172
TspDTI	ATGAA	4 cut(s)	36, 117, 156, 333
Tth111I	GACNNNGTC	1 cut(s)	61
VpaK11BI	GGWCC	2 cut(s)	197, 242
XapI	RAATTY	2 cut(s)	214, 289
XspI	CTAG	1 cut(s)	201

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.