Rmu_ssc0000079.1_g000001

zinc finger protein-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000079.1
OG0009444
Physical Location & Seq
Reverse (-)
1 .. 1998
1998 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000079.1_g000001.1.cds

Sequence Viewer

Length: 321 bp
atggtggtctgcaaatgcaagaaggctaccaagctgtattgtttcgtgcacaaggttccggtttgtggagaatgcatttgtgctccagagcatcaaatttgtgtgattcgtacatactcagaatgggtgatagatggagagtacgattggcctcctaaatgctgtcaatgtcaggttgtgctcgatgaggggactggctctcaaacgacacggcttggttgcttacatgttatacatacaagttgcctggtgtcacatatcaagagtttcccttcgcatactgccccagctggatatgtttgtcctggatgttcgacatcg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

107

Amino Acids

11.75

Weight (kDa)

7.48

Isoelectric Point (pI)

37.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 96
AfaI GTAC 2 cut(s) 112, 143
AfiI CCNNNNNNNGG 1 cut(s) 65
AflIII ACRYGT 1 cut(s) 226
AjnI CCWGG 2 cut(s) 246, 304
AluBI AGCT 2 cut(s) 34, 290
AluI AGCT 2 cut(s) 34, 290
Alw21I GWGCWC 3 cut(s) 51, 85, 183
Alw44I GTGCAC 1 cut(s) 47
AoxI GGCC 1 cut(s) 149
ApaLI GTGCAC 1 cut(s) 47
ApoI RAATTY 1 cut(s) 96
AsuHPI GGTGA 1 cut(s) 139
BaeGI GKGCMC 1 cut(s) 51
Bbv12I GWGCWC 3 cut(s) 51, 85, 183
BccI CCATC 1 cut(s) 128
BceAI ACGGC 1 cut(s) 227
BciT130I CCWGG 2 cut(s) 248, 306
Bme1390I CCNGG 2 cut(s) 248, 306
BmiI GGNNCC 1 cut(s) 57
BmrFI CCNGG 2 cut(s) 248, 306
BmsI GCATC 1 cut(s) 100
BpmI CTGGAG 1 cut(s) 69
BsaWI WCCGGW 1 cut(s) 58
Bsc4I CCNNNNNNNGG 1 cut(s) 65
Bse1I ACTGG 1 cut(s) 199
BseBI CCWGG 2 cut(s) 248, 306
BseGI GGATG 1 cut(s) 314
BseLI CCNNNNNNNGG 1 cut(s) 65
BseMII CTCAG 1 cut(s) 132
BseNI ACTGG 1 cut(s) 199
BseSI GKGCMC 1 cut(s) 51
BseYI CCCAGC 1 cut(s) 286
BshFI GGCC 1 cut(s) 151
BsiHKAI GWGCWC 3 cut(s) 51, 85, 183
BsiSI CCGG 1 cut(s) 59
BslFI GGGAC 1 cut(s) 205
BslI CCNNNNNNNGG 1 cut(s) 65
BsmFI GGGAC 1 cut(s) 205
BsmI GAATGC 1 cut(s) 77
BsnI GGCC 1 cut(s) 151
Bsp1286I GDGCHC 3 cut(s) 51, 85, 183
BspANI GGCC 1 cut(s) 151
BspCNI CTCAG 1 cut(s) 131
BspLI GGNNCC 1 cut(s) 57
BsrI ACTGG 1 cut(s) 199
Bst2UI CCWGG 2 cut(s) 248, 306
BstDEI CTNAG 1 cut(s) 118
BstF5I GGATG 1 cut(s) 314
BstNI CCWGG 2 cut(s) 248, 306
BstNSI RCATGY 1 cut(s) 230
BstSCI CCNGG 2 cut(s) 246, 304
BstSLI GKGCMC 1 cut(s) 51
BsuRI GGCC 1 cut(s) 151
BtsCI GGATG 1 cut(s) 314
Csp6I GTAC 2 cut(s) 111, 142
CviAII CATG 1 cut(s) 227
CviJI RGCY 6 cut(s) 26, 34, 151, 198, 214, 290
CviKI_1 RGCY 6 cut(s) 26, 34, 151, 198, 214, 290
CviQI GTAC 2 cut(s) 111, 142
DdeI CTNAG 1 cut(s) 118
EcoRII CCWGG 2 cut(s) 246, 304
EcoT22I ATGCAT 1 cut(s) 77
FaeI CATG 1 cut(s) 230
FaiI YATR 7 cut(s) 115, 228, 233, 237, 258, 279, 297
FaqI GGGAC 1 cut(s) 205
FatI CATG 1 cut(s) 226
GsaI CCCAGC 1 cut(s) 290
GsuI CTGGAG 1 cut(s) 69
HaeIII GGCC 1 cut(s) 151
HapII CCGG 1 cut(s) 59
Hin1II CATG 1 cut(s) 230
HinfI GANTC 1 cut(s) 106
HpaII CCGG 1 cut(s) 59
HphI GGTGA 1 cut(s) 139
Hpy166II GTNNAC 1 cut(s) 49
Hpy188I TCNGA 1 cut(s) 121
Hpy188III TCNNGA 2 cut(s) 86, 262
Hpy8I GTNNAC 1 cut(s) 49
HpyAV CCTTC 2 cut(s) 16, 282
HpyCH4V TGCA 4 cut(s) 12, 18, 49, 75
HpyF3I CTNAG 1 cut(s) 118
Hsp92II CATG 1 cut(s) 230
LmnI GCTCC 1 cut(s) 88
LpnPI CCDG 9 cut(s) 72, 99, 158, 180, 233, 260, 276, 291, 300
LweI GCATC 1 cut(s) 100
MaeIII GTNAC 1 cut(s) 252
MhlI GDGCHC 3 cut(s) 51, 85, 183
MluCI AATT 1 cut(s) 96
MnlI CCTC 2 cut(s) 162, 181
Mph1103I ATGCAT 1 cut(s) 77
MspA1I CMGCKG 1 cut(s) 290
MspI CCGG 1 cut(s) 59
MspR9I CCNGG 2 cut(s) 248, 306
Mva1269I GAATGC 1 cut(s) 77
MvaI CCWGG 2 cut(s) 248, 306
NlaIII CATG 1 cut(s) 230
NlaIV GGNNCC 1 cut(s) 57
NmuCI GTSAC 1 cut(s) 252
NsiI ATGCAT 1 cut(s) 77
NspI RCATGY 1 cut(s) 230
PciI ACATGT 1 cut(s) 226
PctI GAATGC 1 cut(s) 77
PfeI GAWTC 1 cut(s) 106
PfoI TCCNGGA 1 cut(s) 304
PscI ACATGT 1 cut(s) 226
Psp6I CCWGG 2 cut(s) 246, 304
PspFI CCCAGC 1 cut(s) 286
PspGI CCWGG 2 cut(s) 246, 304
PspN4I GGNNCC 1 cut(s) 57
PvuII CAGCTG 1 cut(s) 290
RsaI GTAC 2 cut(s) 112, 143
RsaNI GTAC 2 cut(s) 111, 142
ScrFI CCNGG 2 cut(s) 248, 306
SduI GDGCHC 3 cut(s) 51, 85, 183
SetI ASST 4 cut(s) 36, 57, 177, 292
SfaNI GCATC 1 cut(s) 100
Sse9I AATT 1 cut(s) 96
StyD4I CCNGG 2 cut(s) 246, 304
TaqI TCGA 2 cut(s) 183, 314
TasI AATT 1 cut(s) 96
TfiI GAWTC 1 cut(s) 106
TseFI GTSAC 1 cut(s) 252
Tsp45I GTSAC 1 cut(s) 252
VneI GTGCAC 1 cut(s) 47
XapI RAATTY 1 cut(s) 96
XceI RCATGY 1 cut(s) 230
Zsp2I ATGCAT 1 cut(s) 77
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.