Rmu_co8256557.1_g000001

Hydroxyproline-rich glycoprotein family protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8256557.1
Physical Location & Seq
Reverse (-)
1 .. 779
779 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8256557.1_g000001.1.cds

Sequence Viewer

Length: 447 bp
atggaccgacagaaagctctgctgcaggagctgatggctaccgtgaaagagatgttacggaacagtgaggttgctgtacgttctttcatgatgctacgtccaaggtttcttcgtccaaatgcaggaggtacttcaaatggcactgcagcgtcacaggctcctggagcaacagaaacaccaggctcaactagtcaaccaacaactacttctatagttccagtttttgacttctataatggagttccaaggaaaccatcccccttcttacagcacacaattgcaagatttgagaaatatcttggtgagtgccgccaatggattgaagaaatagagcagctccttttaaattcagagaggaactcttccaatgatggatcctcattgttgcaatctctcccaaaagtcatgtcaaatgtgcatgacttttttgttcacgtggctgctaag

Protein Analysis

149

Amino Acids

16.58

Weight (kDa)

8.89

Isoelectric Point (pI)

68.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013560)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 310
AclWI GGATC 2 cut(s) 369, 382
AcsI RAATTY 1 cut(s) 346
AcvI CACGTG 1 cut(s) 436
AfaI GTAC 2 cut(s) 78, 130
AfiI CCNNNNNNNGG 1 cut(s) 122
AgsI TTSAA 2 cut(s) 135, 323
AhlI ACTAGT 1 cut(s) 188
AjnI CCWGG 2 cut(s) 160, 178
AjuI GAANNNNNNNTTGG 2 cut(s) 190, 222
AluBI AGCT 3 cut(s) 17, 31, 337
AluI AGCT 3 cut(s) 17, 31, 337
AlwI GGATC 2 cut(s) 369, 382
AlwNI CAGNNNCTG 1 cut(s) 31
ApeKI GCWGC 4 cut(s) 22, 146, 334, 440
ApoI RAATTY 1 cut(s) 346
ArsI GACNNNNNNTTYG 2 cut(s) 392, 424
AspS9I GGNCC 1 cut(s) 4
AsuHPI GGTGA 1 cut(s) 314
AvaII GGWCC 1 cut(s) 4
BamHI GGATCC 1 cut(s) 374
BbrPI CACGTG 1 cut(s) 436
BbvI GCAGC 4 cut(s) 9, 158, 346, 427
BccI CCATC 3 cut(s) 28, 262, 365
BciT130I CCWGG 2 cut(s) 162, 180
BcuI ACTAGT 1 cut(s) 188
BfaI CTAG 1 cut(s) 189
BfmI CTRYAG 3 cut(s) 23, 144, 210
BisI GCNGC 5 cut(s) 23, 147, 310, 335, 441
BlsI GCNGC 5 cut(s) 24, 148, 311, 336, 442
Bme1390I CCNGG 2 cut(s) 162, 180
Bme18I GGWCC 1 cut(s) 4
BmgT120I GGNCC 1 cut(s) 4
BmiI GGNNCC 2 cut(s) 159, 376
BmrFI CCNGG 2 cut(s) 162, 180
BmsI GCATC 1 cut(s) 81
BplI GAGNNNNNCTC 2 cut(s) 344, 376
BpmI CTGGAG 1 cut(s) 183
BsaAI YACGTR 1 cut(s) 436
BsaJI CCNNGG 2 cut(s) 101, 245
Bsc4I CCNNNNNNNGG 1 cut(s) 122
Bse1I ACTGG 1 cut(s) 218
BseBI CCWGG 2 cut(s) 162, 180
BseDI CCNNGG 2 cut(s) 101, 245
BseGI GGATG 1 cut(s) 254
BseLI CCNNNNNNNGG 1 cut(s) 122
BseNI ACTGG 1 cut(s) 218
BseXI GCAGC 4 cut(s) 9, 158, 346, 427
BslI CCNNNNNNNGG 1 cut(s) 122
Bsp143I GATC 1 cut(s) 374
BspACI CCGC 1 cut(s) 310
BspHI TCATGA 1 cut(s) 87
BspLI GGNNCC 2 cut(s) 159, 376
BspMAI CTGCAG 2 cut(s) 27, 148
BspPI GGATC 2 cut(s) 369, 382
BsrI ACTGG 1 cut(s) 218
BssECI CCNNGG 2 cut(s) 101, 245
BssMI GATC 1 cut(s) 374
BssT1I CCWWGG 2 cut(s) 101, 245
Bst2UI CCWGG 2 cut(s) 162, 180
Bst4CI ACNGT 2 cut(s) 43, 65
Bst6I CTCTTC 1 cut(s) 367
BstBAI YACGTR 1 cut(s) 436
BstDEI CTNAG 1 cut(s) 444
BstF5I GGATG 1 cut(s) 254
BstKTI GATC 1 cut(s) 377
BstMBI GATC 1 cut(s) 374
BstMWI GCNNNNNNNGC 3 cut(s) 28, 155, 164
BstNI CCWGG 2 cut(s) 162, 180
BstSCI CCNGG 2 cut(s) 160, 178
BstSFI CTRYAG 3 cut(s) 23, 144, 210
BstV1I GCAGC 4 cut(s) 9, 158, 346, 427
BstX2I RGATCY 1 cut(s) 374
BstYI RGATCY 1 cut(s) 374
BtsCI GGATG 1 cut(s) 254
BtsI GCAGTG 1 cut(s) 141
BtsIMutI CAGTG 2 cut(s) 70, 141
CaiI CAGNNNCTG 1 cut(s) 31
CciI TCATGA 1 cut(s) 87
Cfr13I GGNCC 1 cut(s) 4
CseI GACGC 1 cut(s) 138
Csp6I GTAC 2 cut(s) 77, 129
CviAII CATG 3 cut(s) 88, 406, 419
CviJI RGCY 7 cut(s) 17, 31, 38, 158, 183, 337, 440
CviKI_1 RGCY 7 cut(s) 17, 31, 38, 158, 183, 337, 440
CviQI GTAC 2 cut(s) 77, 129
DdeI CTNAG 1 cut(s) 444
DpnI GATC 1 cut(s) 376
DpnII GATC 1 cut(s) 374
DraI TTTAAA 1 cut(s) 345
Eam1104I CTCTTC 1 cut(s) 367
EarI CTCTTC 1 cut(s) 367
Eco130I CCWWGG 2 cut(s) 101, 245
Eco47I GGWCC 1 cut(s) 4
Eco72I CACGTG 1 cut(s) 436
EcoRII CCWGG 2 cut(s) 160, 178
EcoT14I CCWWGG 2 cut(s) 101, 245
ErhI CCWWGG 2 cut(s) 101, 245
FaeI CATG 3 cut(s) 91, 409, 422
FaiI YATR 5 cut(s) 89, 212, 234, 407, 420
FatI CATG 3 cut(s) 87, 405, 418
Fnu4HI GCNGC 5 cut(s) 23, 147, 310, 335, 441
FokI GGATG 1 cut(s) 241
Fsp4HI GCNGC 5 cut(s) 23, 147, 310, 335, 441
FspBI CTAG 1 cut(s) 189
GluI GCNGC 5 cut(s) 23, 147, 310, 335, 441
GsuI CTGGAG 1 cut(s) 183
HgaI GACGC 1 cut(s) 138
Hin1II CATG 3 cut(s) 91, 409, 422
HincII GTYRAC 1 cut(s) 194
HindII GTYRAC 1 cut(s) 194
HphI GGTGA 1 cut(s) 314
Hpy166II GTNNAC 2 cut(s) 194, 433
Hpy188I TCNGA 1 cut(s) 352
Hpy188III TCNNGA 1 cut(s) 88
Hpy8I GTNNAC 2 cut(s) 194, 433
HpyAV CCTTC 1 cut(s) 271
HpyCH4III ACNGT 2 cut(s) 43, 65
HpyCH4IV ACGT 3 cut(s) 79, 97, 435
HpyCH4V TGCA 6 cut(s) 25, 122, 146, 281, 388, 418
HpyF10VI GCNNNNNNNGC 3 cut(s) 28, 155, 164
HpyF3I CTNAG 1 cut(s) 444
HpySE526I ACGT 3 cut(s) 79, 97, 435
Hsp92II CATG 3 cut(s) 91, 409, 422
Kzo9I GATC 1 cut(s) 374
LmnI GCTCC 4 cut(s) 28, 163, 164, 342
LpnPI CCDG 8 cut(s) 11, 108, 140, 147, 165, 174, 192, 231
Lsp1109I GCAGC 4 cut(s) 9, 158, 346, 427
LweI GCATC 1 cut(s) 81
MaeI CTAG 1 cut(s) 189
MaeII ACGT 3 cut(s) 79, 97, 435
MaeIII GTNAC 2 cut(s) 54, 150
MalI GATC 1 cut(s) 376
MboI GATC 1 cut(s) 374
MboII GAAGA 3 cut(s) 101, 335, 354
MfeI CAATTG 1 cut(s) 276
MflI RGATCY 1 cut(s) 374
MluCI AATT 2 cut(s) 276, 346
MnlI CCTC 4 cut(s) 61, 119, 348, 388
MseI TTAA 1 cut(s) 344
MspR9I CCNGG 2 cut(s) 162, 180
MunI CAATTG 1 cut(s) 276
MvaI CCWGG 2 cut(s) 162, 180
MwoI GCNNNNNNNGC 3 cut(s) 28, 155, 164
NdeII GATC 1 cut(s) 374
NlaIII CATG 3 cut(s) 91, 409, 422
NlaIV GGNNCC 2 cut(s) 159, 376
NmuCI GTSAC 1 cut(s) 150
PagI TCATGA 1 cut(s) 87
PfoI TCCNGGA 1 cut(s) 160
PkrI GCNGC 5 cut(s) 24, 148, 311, 336, 442
PmaCI CACGTG 1 cut(s) 436
PmlI CACGTG 1 cut(s) 436
Ppu21I YACGTR 1 cut(s) 436
Psp6I CCWGG 2 cut(s) 160, 178
PspCI CACGTG 1 cut(s) 436
PspGI CCWGG 2 cut(s) 160, 178
PspN4I GGNNCC 2 cut(s) 159, 376
PspPI GGNCC 1 cut(s) 4
PstI CTGCAG 2 cut(s) 27, 148
PstNI CAGNNNCTG 1 cut(s) 31
PsuI RGATCY 1 cut(s) 374
RsaI GTAC 2 cut(s) 78, 130
RsaNI GTAC 2 cut(s) 77, 129
SaqAI TTAA 1 cut(s) 344
SatI GCNGC 5 cut(s) 23, 147, 310, 335, 441
Sau3AI GATC 1 cut(s) 374
Sau96I GGNCC 1 cut(s) 4
ScrFI CCNGG 2 cut(s) 162, 180
SetI ASST 9 cut(s) 19, 33, 72, 82, 100, 107, 130, 339, 438
SfaNI GCATC 1 cut(s) 81
SfcI CTRYAG 3 cut(s) 23, 144, 210
SinI GGWCC 1 cut(s) 4
SpeI ACTAGT 1 cut(s) 188
Sse9I AATT 2 cut(s) 276, 346
SsiI CCGC 1 cut(s) 310
SspMI CTAG 1 cut(s) 189
StyD4I CCNGG 2 cut(s) 160, 178
StyI CCWWGG 2 cut(s) 101, 245
TaaI ACNGT 2 cut(s) 43, 65
TaiI ACGT 3 cut(s) 82, 100, 438
TaqII GACCGA 1 cut(s) 21
TasI AATT 2 cut(s) 276, 346
TauI GCSGC 1 cut(s) 312
Tru1I TTAA 1 cut(s) 344
Tru9I TTAA 1 cut(s) 344
TscAI CASTG 2 cut(s) 70, 148
TseFI GTSAC 1 cut(s) 150
TseI GCWGC 4 cut(s) 22, 146, 334, 440
Tsp45I GTSAC 1 cut(s) 150
TspDTI ATGAA 1 cut(s) 76
TspGWI ACGGA 1 cut(s) 73
TspRI CASTG 2 cut(s) 70, 148
VpaK11BI GGWCC 1 cut(s) 4
XapI RAATTY 1 cut(s) 346
XspI CTAG 1 cut(s) 189
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.