Rmu_co8286683.1_g000001

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8286683.1
OG0014671
Physical Location & Seq
Reverse (-)
441 .. 725
285 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8286683.1_g000001.1.cds

Sequence Viewer

Length: 285 bp
atgaaacaagctctggacattgctgcacgagcactggtggaggttgtggaggccaggctctccattgaggaggctgctggagacactgaggaggcccccggagacactcaggaggctgaggaggccagggtcgccgttgtggaggccgccggagacactaaagaagctgaggagtccagggtagccgttgcggaggccgccagagacactgaggaggccagggtggccgttacggtggccgccagagacactgaggaggctggagacattactatcgaacactga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

94

Amino Acids

9.88

Weight (kDa)

4.15

Isoelectric Point (pI)

46.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 4 cut(s) 147, 191, 198, 240
AcoI YGGCCR 2 cut(s) 225, 237
AjnI CCWGG 4 cut(s) 53, 125, 176, 218
AluBI AGCT 2 cut(s) 11, 167
AluI AGCT 2 cut(s) 11, 167
Alw21I GWGCWC 1 cut(s) 34
Alw26I GTCTC 6 cut(s) 75, 96, 147, 198, 240, 258
AoxI GGCC 8 cut(s) 51, 93, 123, 144, 195, 216, 225, 237
ApeKI GCWGC 2 cut(s) 23, 74
AspS9I GGNCC 1 cut(s) 94
AsuC2I CCSGG 1 cut(s) 99
BauI CACGAG 1 cut(s) 27
Bbv12I GWGCWC 1 cut(s) 34
BbvCI CCTCAGC 2 cut(s) 117, 168
BbvI GCAGC 2 cut(s) 10, 61
BceAI ACGGC 3 cut(s) 119, 170, 212
BciT130I CCWGG 4 cut(s) 55, 127, 178, 220
BcnI CCSGG 1 cut(s) 99
BcoDI GTCTC 6 cut(s) 75, 96, 147, 198, 240, 258
BglI GCCNNNNNGGC 1 cut(s) 224
BisI GCNGC 5 cut(s) 24, 75, 147, 198, 240
BlsI GCNGC 5 cut(s) 25, 76, 148, 199, 241
Bme1390I CCNGG 5 cut(s) 55, 99, 127, 178, 220
BmgT120I GGNCC 1 cut(s) 94
BmiI GGNNCC 1 cut(s) 96
BmrFI CCNGG 5 cut(s) 55, 99, 127, 178, 220
BpmI CTGGAG 2 cut(s) 99, 282
Bpu10I CCTNAGC 2 cut(s) 117, 168
BpuMI CCSGG 1 cut(s) 99
BsaJI CCNNGG 4 cut(s) 97, 126, 177, 219
Bse1I ACTGG 1 cut(s) 39
Bse3DI GCAATG 1 cut(s) 18
BseBI CCWGG 4 cut(s) 55, 127, 178, 220
BseDI CCNNGG 4 cut(s) 97, 126, 177, 219
BseMI GCAATG 1 cut(s) 18
BseMII CTCAG 6 cut(s) 78, 108, 122, 159, 201, 243
BseNI ACTGG 1 cut(s) 39
BseRI GAGGAG 6 cut(s) 83, 104, 134, 185, 227, 269
BseXI GCAGC 2 cut(s) 10, 61
BsgI GTGCAG 1 cut(s) 9
BshFI GGCC 8 cut(s) 53, 95, 125, 146, 197, 218, 227, 239
BsiHKAI GWGCWC 1 cut(s) 34
BsiSI CCGG 2 cut(s) 99, 150
BsmAI GTCTC 6 cut(s) 75, 96, 147, 198, 240, 258
BsnI GGCC 8 cut(s) 53, 95, 125, 146, 197, 218, 227, 239
Bsp1286I GDGCHC 1 cut(s) 34
BspACI CCGC 4 cut(s) 147, 191, 198, 240
BspANI GGCC 8 cut(s) 53, 95, 125, 146, 197, 218, 227, 239
BspCNI CTCAG 6 cut(s) 79, 109, 121, 160, 202, 244
BspLI GGNNCC 1 cut(s) 96
BsrDI GCAATG 1 cut(s) 18
BsrI ACTGG 1 cut(s) 39
BssECI CCNNGG 4 cut(s) 97, 126, 177, 219
BssSI CACGAG 1 cut(s) 27
Bst2BI CACGAG 1 cut(s) 27
Bst2UI CCWGG 4 cut(s) 55, 127, 178, 220
Bst4CI ACNGT 1 cut(s) 235
BstDEI CTNAG 6 cut(s) 87, 108, 117, 168, 210, 252
BstMAI GTCTC 6 cut(s) 75, 96, 147, 198, 240, 258
BstMWI GCNNNNNNNGC 5 cut(s) 29, 122, 131, 197, 224
BstNI CCWGG 4 cut(s) 55, 127, 178, 220
BstSCI CCNGG 5 cut(s) 53, 97, 125, 176, 218
BstV1I GCAGC 2 cut(s) 10, 61
BsuRI GGCC 8 cut(s) 53, 95, 125, 146, 197, 218, 227, 239
BtsIMutI CAGTG 5 cut(s) 32, 84, 207, 249, 280
Cfr13I GGNCC 1 cut(s) 94
DdeI CTNAG 6 cut(s) 87, 108, 117, 168, 210, 252
EaeI YGGCCR 2 cut(s) 225, 237
EcoO109I RGGNCCY 1 cut(s) 94
EcoRII CCWGG 4 cut(s) 53, 125, 176, 218
Fnu4HI GCNGC 5 cut(s) 24, 75, 147, 198, 240
Fsp4HI GCNGC 5 cut(s) 24, 75, 147, 198, 240
GluI GCNGC 5 cut(s) 24, 75, 147, 198, 240
GsuI CTGGAG 2 cut(s) 99, 282
HaeIII GGCC 8 cut(s) 53, 95, 125, 146, 197, 218, 227, 239
HapII CCGG 2 cut(s) 99, 150
HinfI GANTC 1 cut(s) 173
HpaII CCGG 2 cut(s) 99, 150
Hpy188III TCNNGA 2 cut(s) 14, 110
HpyCH4III ACNGT 1 cut(s) 235
HpyCH4V TGCA 1 cut(s) 26
HpyF10VI GCNNNNNNNGC 5 cut(s) 29, 122, 131, 197, 224
HpyF3I CTNAG 6 cut(s) 87, 108, 117, 168, 210, 252
Lsp1109I GCAGC 2 cut(s) 10, 61
MaeIII GTNAC 1 cut(s) 229
MhlI GDGCHC 1 cut(s) 34
MlyI GAGTC 1 cut(s) 182
MspI CCGG 2 cut(s) 99, 150
MspR9I CCNGG 5 cut(s) 55, 99, 127, 178, 220
MvaI CCWGG 4 cut(s) 55, 127, 178, 220
MwoI GCNNNNNNNGC 5 cut(s) 29, 122, 131, 197, 224
NciI CCSGG 1 cut(s) 99
NlaIV GGNNCC 1 cut(s) 96
PkrI GCNGC 5 cut(s) 25, 76, 148, 199, 241
PleI GAGTC 1 cut(s) 181
PpsI GAGTC 1 cut(s) 181
Psp6I CCWGG 4 cut(s) 53, 125, 176, 218
PspGI CCWGG 4 cut(s) 53, 125, 176, 218
PspN4I GGNNCC 1 cut(s) 96
PspPI GGNCC 1 cut(s) 94
SatI GCNGC 5 cut(s) 24, 75, 147, 198, 240
Sau96I GGNCC 1 cut(s) 94
SchI GAGTC 1 cut(s) 182
ScrFI CCNGG 5 cut(s) 55, 99, 127, 178, 220
SduI GDGCHC 1 cut(s) 34
SetI ASST 3 cut(s) 13, 45, 169
SfiI GGCCNNNNNGGCC 1 cut(s) 224
SsiI CCGC 4 cut(s) 147, 191, 198, 240
StyD4I CCNGG 5 cut(s) 53, 97, 125, 176, 218
TaaI ACNGT 1 cut(s) 235
TaqI TCGA 1 cut(s) 276
TauI GCSGC 3 cut(s) 149, 200, 242
TscAI CASTG 4 cut(s) 39, 91, 214, 256
TseI GCWGC 2 cut(s) 23, 74
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 4 cut(s) 39, 91, 214, 256
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.