Rmu_sc0023155.1_g000001

Dymeclin-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0023155.1
OG0014671
Physical Location & Seq
Reverse (-)
2 .. 1959
1958 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0023155.1_g000001.1.cds

Sequence Viewer

Length: 699 bp
atgctgattgcaatgtcaactcagcttctttctgggccatctccaggaccagaagatgtgaacccatttcttgatgcagcaatgtctcaggaaagctcgttggttatctcggttgttcgtagactgctactcaactacatcactggaccttcgatacccctgaatagtgcatcttattctatattttctgaaggaagccagcctggtgttatacaaagagttagttctgcagcagcaaatttgatgttattaccattcaactttctcgtcagttcaagtggtgaaggctcaagaagtcttttggccgactgcagtctccatgtgctacttattctcactcattatcataaatgtgttgtgggcaacgagccaataacagattcaagtactgacaccactacttcaaattcacttttgaaagggagtagatatttttctgacaacccttactgcaaggccttggaacatgcaacagatgttgaatttgatcgtgtagatactgagggtaacgcacatagtggtccagttttgaggttaccttttgcttccctgttcgatacccttggaatgtacttgtctgatgaggctgctgcacttttgctttactctttattgcaaggaaatgctgactttctggagtatgtcttggtgcgaactgatttggatacgctgttgatgcccatcctggaagcgttatat
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Dymeclin

Protein Analysis

233

Amino Acids

25.19

Weight (kDa)

4.48

Isoelectric Point (pI)

42.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 121
AcoI YGGCCR 1 cut(s) 303
AcsI RAATTY 3 cut(s) 238, 406, 482
AcuI CTGAAG 1 cut(s) 210
AdeI CACNNNGTG 1 cut(s) 518
AfaI GTAC 2 cut(s) 388, 572
AfiI CCNNNNNNNGG 1 cut(s) 44
AgsI TTSAA 6 cut(s) 259, 276, 384, 405, 418, 482
AjnI CCWGG 3 cut(s) 43, 202, 684
AjuI GAANNNNNNNTTGG 2 cut(s) 364, 396
AluBI AGCT 2 cut(s) 25, 96
AluI AGCT 2 cut(s) 25, 96
Alw26I GTCTC 2 cut(s) 90, 320
AoxI GGCC 3 cut(s) 35, 303, 456
ApeKI GCWGC 5 cut(s) 77, 230, 233, 587, 590
ApoI RAATTY 3 cut(s) 238, 406, 482
AspS9I GGNCC 4 cut(s) 35, 47, 146, 521
AsuHPI GGTGA 1 cut(s) 293
AvaII GGWCC 3 cut(s) 47, 146, 521
BbvI GCAGC 5 cut(s) 89, 242, 245, 574, 577
BccI CCATC 2 cut(s) 46, 689
BciT130I CCWGG 3 cut(s) 45, 204, 686
BciVI GTATCC 1 cut(s) 658
BcoDI GTCTC 2 cut(s) 90, 320
BfmI CTRYAG 2 cut(s) 228, 310
BfuI GTATCC 1 cut(s) 658
BisI GCNGC 5 cut(s) 78, 231, 234, 588, 591
BlsI GCNGC 5 cut(s) 79, 232, 235, 589, 592
BmcAI AGTACT 1 cut(s) 388
Bme1390I CCNGG 3 cut(s) 45, 204, 686
Bme18I GGWCC 3 cut(s) 47, 146, 521
BmgT120I GGNCC 4 cut(s) 35, 47, 146, 521
BmrFI CCNGG 3 cut(s) 45, 204, 686
BmsI GCATC 3 cut(s) 64, 179, 666
BoxI GACNNNNGTC 1 cut(s) 312
BpmI CTGGAG 2 cut(s) 27, 656
BpuEI CTTGAG 1 cut(s) 274
BsaBI GATNNNNATC 1 cut(s) 680
BsaJI CCNNGG 2 cut(s) 459, 562
Bsc4I CCNNNNNNNGG 1 cut(s) 44
Bse1I ACTGG 2 cut(s) 148, 524
Bse3DI GCAATG 2 cut(s) 18, 87
Bse8I GATNNNNATC 1 cut(s) 680
BseBI CCWGG 3 cut(s) 45, 204, 686
BseDI CCNNGG 2 cut(s) 459, 562
BseGI GGATG 1 cut(s) 681
BseJI GATNNNNATC 1 cut(s) 680
BseLI CCNNNNNNNGG 1 cut(s) 44
BseMI GCAATG 2 cut(s) 18, 87
BseMII CTCAG 3 cut(s) 35, 101, 492
BseNI ACTGG 2 cut(s) 148, 524
BseXI GCAGC 5 cut(s) 89, 242, 245, 574, 577
BsgI GTGCAG 1 cut(s) 576
BshFI GGCC 3 cut(s) 37, 305, 458
BslI CCNNNNNNNGG 1 cut(s) 44
BsmAI GTCTC 2 cut(s) 90, 320
BsnI GGCC 3 cut(s) 37, 305, 458
Bsp143I GATC 1 cut(s) 487
BspANI GGCC 3 cut(s) 37, 305, 458
BspCNI CTCAG 3 cut(s) 34, 100, 493
BspMAI CTGCAG 2 cut(s) 232, 314
BsrDI GCAATG 2 cut(s) 18, 87
BsrI ACTGG 2 cut(s) 148, 524
BssECI CCNNGG 2 cut(s) 459, 562
BssMI GATC 1 cut(s) 487
BssT1I CCWWGG 2 cut(s) 459, 562
Bst2UI CCWGG 3 cut(s) 45, 204, 686
BstC8I GCNNGC 1 cut(s) 200
BstDEI CTNAG 3 cut(s) 21, 87, 501
BstEII GGTNACC 1 cut(s) 534
BstF5I GGATG 1 cut(s) 681
BstKTI GATC 1 cut(s) 490
BstMAI GTCTC 2 cut(s) 90, 320
BstMBI GATC 1 cut(s) 487
BstMWI GCNNNNNNNGC 1 cut(s) 676
BstNI CCWGG 3 cut(s) 45, 204, 686
BstNSI RCATGY 1 cut(s) 470
BstPAI GACNNNNGTC 1 cut(s) 312
BstPI GGTNACC 1 cut(s) 534
BstSCI CCNGG 3 cut(s) 43, 202, 684
BstSFI CTRYAG 2 cut(s) 228, 310
BstV1I GCAGC 5 cut(s) 89, 242, 245, 574, 577
BsuI GTATCC 1 cut(s) 658
BsuRI GGCC 3 cut(s) 37, 305, 458
BtsCI GGATG 1 cut(s) 681
BtsIMutI CAGTG 1 cut(s) 141
Cac8I GCNNGC 1 cut(s) 200
Cfr13I GGNCC 4 cut(s) 35, 47, 146, 521
Csp6I GTAC 2 cut(s) 387, 571
CviAII CATG 2 cut(s) 320, 467
CviQI GTAC 2 cut(s) 387, 571
DdeI CTNAG 3 cut(s) 21, 87, 501
DpnI GATC 1 cut(s) 489
DpnII GATC 1 cut(s) 487
DraIII CACNNNGTG 1 cut(s) 518
EaeI YGGCCR 1 cut(s) 303
Eco130I CCWWGG 2 cut(s) 459, 562
Eco147I AGGCCT 1 cut(s) 458
Eco47I GGWCC 3 cut(s) 47, 146, 521
Eco57I CTGAAG 1 cut(s) 210
Eco91I GGTNACC 1 cut(s) 534
EcoO65I GGTNACC 1 cut(s) 534
EcoRII CCWGG 3 cut(s) 43, 202, 684
EcoT14I CCWWGG 2 cut(s) 459, 562
ErhI CCWWGG 2 cut(s) 459, 562
FaeI CATG 2 cut(s) 323, 470
FaiI YATR 8 cut(s) 182, 212, 321, 348, 468, 516, 642, 697
FatI CATG 2 cut(s) 319, 466
FblI GTMKAC 1 cut(s) 121
Fnu4HI GCNGC 5 cut(s) 78, 231, 234, 588, 591
FokI GGATG 1 cut(s) 668
Fsp4HI GCNGC 5 cut(s) 78, 231, 234, 588, 591
GluI GCNGC 5 cut(s) 78, 231, 234, 588, 591
GsuI CTGGAG 2 cut(s) 27, 656
HaeIII GGCC 3 cut(s) 37, 305, 458
Hin1II CATG 2 cut(s) 323, 470
HincII GTYRAC 1 cut(s) 18
HindII GTYRAC 1 cut(s) 18
HinfI GANTC 1 cut(s) 380
HphI GGTGA 1 cut(s) 293
Hpy166II GTNNAC 3 cut(s) 18, 61, 122
Hpy188I TCNGA 3 cut(s) 190, 439, 580
Hpy188III TCNNGA 4 cut(s) 71, 89, 291, 635
Hpy8I GTNNAC 3 cut(s) 18, 61, 122
HpyAV CCTTC 3 cut(s) 159, 185, 278
HpyCH4V TGCA 9 cut(s) 11, 77, 170, 230, 312, 453, 470, 593, 616
HpyF10VI GCNNNNNNNGC 1 cut(s) 676
HpyF3I CTNAG 3 cut(s) 21, 87, 501
Hsp92II CATG 2 cut(s) 323, 470
Kzo9I GATC 1 cut(s) 487
Lsp1109I GCAGC 5 cut(s) 89, 242, 245, 574, 577
LweI GCATC 3 cut(s) 64, 179, 666
MaeIII GTNAC 2 cut(s) 506, 534
MalI GATC 1 cut(s) 489
MboI GATC 1 cut(s) 487
MboII GAAGA 1 cut(s) 65
MluCI AATT 3 cut(s) 238, 406, 482
MnlI CCTC 3 cut(s) 496, 525, 577
MslI CAYNNNNRTG 1 cut(s) 351
MspR9I CCNGG 3 cut(s) 45, 204, 686
MvaI CCWGG 3 cut(s) 45, 204, 686
MwoI GCNNNNNNNGC 1 cut(s) 676
NdeII GATC 1 cut(s) 487
NlaIII CATG 2 cut(s) 323, 470
NspI RCATGY 1 cut(s) 470
PceI AGGCCT 1 cut(s) 458
PfeI GAWTC 1 cut(s) 380
PfoI TCCNGGA 2 cut(s) 43, 684
PkrI GCNGC 5 cut(s) 79, 232, 235, 589, 592
PshAI GACNNNNGTC 1 cut(s) 312
Psp6I CCWGG 3 cut(s) 43, 202, 684
PspEI GGTNACC 1 cut(s) 534
PspGI CCWGG 3 cut(s) 43, 202, 684
PspPI GGNCC 4 cut(s) 35, 47, 146, 521
PstI CTGCAG 2 cut(s) 232, 314
RsaI GTAC 2 cut(s) 388, 572
RsaNI GTAC 2 cut(s) 387, 571
RseI CAYNNNNRTG 1 cut(s) 351
SatI GCNGC 5 cut(s) 78, 231, 234, 588, 591
Sau3AI GATC 1 cut(s) 487
Sau96I GGNCC 4 cut(s) 35, 47, 146, 521
ScaI AGTACT 1 cut(s) 388
ScrFI CCNGG 3 cut(s) 45, 204, 686
SetI ASST 5 cut(s) 27, 98, 151, 536, 541
SfaNI GCATC 3 cut(s) 64, 179, 666
SfcI CTRYAG 2 cut(s) 228, 310
SinI GGWCC 3 cut(s) 47, 146, 521
SmiMI CAYNNNNRTG 1 cut(s) 351
SmlI CTYRAG 1 cut(s) 289
SmoI CTYRAG 1 cut(s) 289
Sse9I AATT 3 cut(s) 238, 406, 482
SseBI AGGCCT 1 cut(s) 458
StuI AGGCCT 1 cut(s) 458
StyD4I CCNGG 3 cut(s) 43, 202, 684
StyI CCWWGG 2 cut(s) 459, 562
TaqI TCGA 2 cut(s) 152, 555
TasI AATT 3 cut(s) 238, 406, 482
TatI WGTACW 2 cut(s) 386, 570
TfiI GAWTC 1 cut(s) 380
TscAI CASTG 1 cut(s) 148
TseI GCWGC 5 cut(s) 77, 230, 233, 587, 590
TspRI CASTG 1 cut(s) 148
VpaK11BI GGWCC 3 cut(s) 47, 146, 521
XapI RAATTY 3 cut(s) 238, 406, 482
XceI RCATGY 1 cut(s) 470
XmiI GTMKAC 1 cut(s) 121
ZrmI AGTACT 1 cut(s) 388
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.