Rh4CG321300

Dymeclin-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Reverse (-)
58365867 .. 58366670
804 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG321300.1

Sequence Viewer

Length: 222 bp
ATGGCCTTGGAACATGCAACGGATGTTGAATTTGATCGTGTAGATACTGAGGGTAATGCACATAGTGGTCCAGTTTTGAGGTTACCCTTTGCTTCTCTGTTCGATACCCTTGGAATGTACTTGACTGATGAGGCTGTTGCACTTTTGCTTTCTCTTTATTGCAAGGAAATGCTGACTTTCTGGAGTATGTCTTGGTGCAAACTGATTTGGATACACTGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

73

Amino Acids

8.35

Weight (kDa)

4.63

Isoelectric Point (pI)

29.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 29
AdeI CACNNNGTG 1 cut(s) 65
AfaI GTAC 1 cut(s) 119
AgsI TTSAA 1 cut(s) 29
AoxI GGCC 1 cut(s) 3
ApoI RAATTY 1 cut(s) 29
AspS9I GGNCC 1 cut(s) 68
AvaII GGWCC 1 cut(s) 68
BciVI GTATCC 1 cut(s) 204
BfuI GTATCC 1 cut(s) 204
Bme18I GGWCC 1 cut(s) 68
BmgT120I GGNCC 1 cut(s) 68
BpmI CTGGAG 1 cut(s) 202
BsaJI CCNNGG 2 cut(s) 6, 109
Bse1I ACTGG 1 cut(s) 71
BseDI CCNNGG 2 cut(s) 6, 109
BseGI GGATG 1 cut(s) 28
BseMII CTCAG 1 cut(s) 39
BseNI ACTGG 1 cut(s) 71
BshFI GGCC 1 cut(s) 5
BsnI GGCC 1 cut(s) 5
Bsp143I GATC 1 cut(s) 34
BspANI GGCC 1 cut(s) 5
BspCNI CTCAG 1 cut(s) 40
BsrI ACTGG 1 cut(s) 71
BssECI CCNNGG 2 cut(s) 6, 109
BssMI GATC 1 cut(s) 34
BssT1I CCWWGG 2 cut(s) 6, 109
Bst4CI ACNGT 1 cut(s) 218
BstDEI CTNAG 1 cut(s) 48
BstEII GGTNACC 1 cut(s) 81
BstF5I GGATG 1 cut(s) 28
BstKTI GATC 1 cut(s) 37
BstMBI GATC 1 cut(s) 34
BstNSI RCATGY 1 cut(s) 17
BstPI GGTNACC 1 cut(s) 81
BsuI GTATCC 1 cut(s) 204
BsuRI GGCC 1 cut(s) 5
BtsCI GGATG 1 cut(s) 28
BtsIMutI CAGTG 1 cut(s) 214
Cfr13I GGNCC 1 cut(s) 68
Csp6I GTAC 1 cut(s) 118
CviAII CATG 1 cut(s) 14
CviJI RGCY 2 cut(s) 5, 134
CviKI_1 RGCY 2 cut(s) 5, 134
CviQI GTAC 1 cut(s) 118
DdeI CTNAG 1 cut(s) 48
DpnI GATC 1 cut(s) 36
DpnII GATC 1 cut(s) 34
DraIII CACNNNGTG 1 cut(s) 65
Eco130I CCWWGG 2 cut(s) 6, 109
Eco47I GGWCC 1 cut(s) 68
Eco91I GGTNACC 1 cut(s) 81
EcoO65I GGTNACC 1 cut(s) 81
EcoT14I CCWWGG 2 cut(s) 6, 109
ErhI CCWWGG 2 cut(s) 6, 109
FaeI CATG 1 cut(s) 17
FaiI YATR 3 cut(s) 15, 63, 188
FatI CATG 1 cut(s) 13
FokI GGATG 1 cut(s) 35
GsuI CTGGAG 1 cut(s) 202
HaeIII GGCC 1 cut(s) 5
Hin1II CATG 1 cut(s) 17
Hpy188III TCNNGA 1 cut(s) 181
HpyCH4III ACNGT 1 cut(s) 218
HpyCH4V TGCA 5 cut(s) 17, 59, 140, 162, 198
HpyF3I CTNAG 1 cut(s) 48
Hsp92II CATG 1 cut(s) 17
Kzo9I GATC 1 cut(s) 34
LpnPI CCDG 2 cut(s) 84, 166
MaeIII GTNAC 1 cut(s) 81
MalI GATC 1 cut(s) 36
MboI GATC 1 cut(s) 34
MluCI AATT 1 cut(s) 29
MnlI CCTC 3 cut(s) 43, 72, 124
NdeII GATC 1 cut(s) 34
NlaIII CATG 1 cut(s) 17
NspI RCATGY 1 cut(s) 17
PspEI GGTNACC 1 cut(s) 81
PspPI GGNCC 1 cut(s) 68
RsaI GTAC 1 cut(s) 119
RsaNI GTAC 1 cut(s) 118
Sau3AI GATC 1 cut(s) 34
Sau96I GGNCC 1 cut(s) 68
SetI ASST 1 cut(s) 83
SgeI CNNG 9 cut(s) 19, 26, 50, 83, 122, 133, 175, 193, 204
SinI GGWCC 1 cut(s) 68
Sse9I AATT 1 cut(s) 29
StyI CCWWGG 2 cut(s) 6, 109
TaaI ACNGT 1 cut(s) 218
TaqI TCGA 1 cut(s) 102
TasI AATT 1 cut(s) 29
TatI WGTACW 1 cut(s) 117
TscAI CASTG 1 cut(s) 221
TspGWI ACGGA 1 cut(s) 35
TspRI CASTG 1 cut(s) 221
VpaK11BI GGWCC 1 cut(s) 68
XapI RAATTY 1 cut(s) 29
XceI RCATGY 1 cut(s) 17
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.