Rmu_sc0000131.1_g000053

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000131.1
OG0014671
Physical Location & Seq
Forward (+)
267519 .. 267842
324 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000131.1_g000053.1.cds

Sequence Viewer

Length: 324 bp
ctggacattgctgcacgagcactggtggaggttgtggaggccaggctcgccgttgaggaggctgctggagacactgaggaggctgaggaggccgctggagacactgaagaggctgctggagacactaaggaggcccccggagacactcaggaggctgaggaggccagggtcgccgttgtggaggccgctggagatactaaggaagctgaggagtccagggtagccgttgcggaggccgccagagacactgaggaggccagggtcgctgttactgtggccgccagagacactgaggaggctggagacattactatcgaacaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

107

Amino Acids

11.05

Weight (kDa)

4.05

Isoelectric Point (pI)

43.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 5 cut(s) 93, 186, 230, 237, 279
AcoI YGGCCR 1 cut(s) 276
AcuI CTGAAG 1 cut(s) 126
AjnI CCWGG 4 cut(s) 41, 164, 215, 257
AluBI AGCT 1 cut(s) 206
AluI AGCT 1 cut(s) 206
Alw21I GWGCWC 1 cut(s) 22
Alw26I GTCTC 7 cut(s) 63, 93, 114, 135, 237, 279, 297
AoxI GGCC 8 cut(s) 39, 90, 132, 162, 183, 234, 255, 276
ApeKI GCWGC 3 cut(s) 11, 62, 113
AspS9I GGNCC 1 cut(s) 133
AsuC2I CCSGG 1 cut(s) 138
BauI CACGAG 1 cut(s) 15
Bbv12I GWGCWC 1 cut(s) 22
BbvCI CCTCAGC 3 cut(s) 84, 156, 207
BbvI GCAGC 2 cut(s) 49, 100
BceAI ACGGC 3 cut(s) 35, 158, 209
BciT130I CCWGG 4 cut(s) 43, 166, 217, 259
BcnI CCSGG 1 cut(s) 138
BcoDI GTCTC 7 cut(s) 63, 93, 114, 135, 237, 279, 297
BisI GCNGC 7 cut(s) 12, 63, 93, 114, 186, 237, 279
BlsI GCNGC 7 cut(s) 13, 64, 94, 115, 187, 238, 280
Bme1390I CCNGG 5 cut(s) 43, 138, 166, 217, 259
BmgT120I GGNCC 1 cut(s) 133
BmiI GGNNCC 1 cut(s) 135
BmrFI CCNGG 5 cut(s) 43, 138, 166, 217, 259
BpmI CTGGAG 5 cut(s) 87, 117, 138, 210, 321
Bpu10I CCTNAGC 3 cut(s) 84, 156, 207
BpuMI CCSGG 1 cut(s) 138
BsaJI CCNNGG 4 cut(s) 136, 165, 216, 258
Bse1I ACTGG 1 cut(s) 27
Bse3DI GCAATG 1 cut(s) 6
BseBI CCWGG 4 cut(s) 43, 166, 217, 259
BseDI CCNNGG 4 cut(s) 136, 165, 216, 258
BseMI GCAATG 1 cut(s) 6
BseMII CTCAG 7 cut(s) 66, 75, 147, 161, 198, 240, 282
BseNI ACTGG 1 cut(s) 27
BseRI GAGGAG 7 cut(s) 71, 92, 101, 173, 224, 266, 308
BseXI GCAGC 2 cut(s) 49, 100
BshFI GGCC 8 cut(s) 41, 92, 134, 164, 185, 236, 257, 278
BsiHKAI GWGCWC 1 cut(s) 22
BsiSI CCGG 1 cut(s) 138
BsmAI GTCTC 7 cut(s) 63, 93, 114, 135, 237, 279, 297
BsnI GGCC 8 cut(s) 41, 92, 134, 164, 185, 236, 257, 278
Bsp1286I GDGCHC 1 cut(s) 22
BspACI CCGC 5 cut(s) 93, 186, 230, 237, 279
BspANI GGCC 8 cut(s) 41, 92, 134, 164, 185, 236, 257, 278
BspCNI CTCAG 7 cut(s) 67, 76, 148, 160, 199, 241, 283
BspLI GGNNCC 1 cut(s) 135
BsrDI GCAATG 1 cut(s) 6
BsrI ACTGG 1 cut(s) 27
BssECI CCNNGG 4 cut(s) 136, 165, 216, 258
BssSI CACGAG 1 cut(s) 15
Bst2BI CACGAG 1 cut(s) 15
Bst2UI CCWGG 4 cut(s) 43, 166, 217, 259
Bst4CI ACNGT 1 cut(s) 274
Bst6I CTCTTC 1 cut(s) 102
BstC8I GCNNGC 1 cut(s) 48
BstDEI CTNAG 9 cut(s) 75, 84, 126, 147, 156, 198, 207, 249, 291
BstMAI GTCTC 7 cut(s) 63, 93, 114, 135, 237, 279, 297
BstMWI GCNNNNNNNGC 7 cut(s) 17, 47, 89, 161, 170, 236, 263
BstNI CCWGG 4 cut(s) 43, 166, 217, 259
BstSCI CCNGG 5 cut(s) 41, 136, 164, 215, 257
BstV1I GCAGC 2 cut(s) 49, 100
BsuRI GGCC 8 cut(s) 41, 92, 134, 164, 185, 236, 257, 278
BtsIMutI CAGTG 5 cut(s) 20, 72, 102, 246, 288
Cac8I GCNNGC 1 cut(s) 48
Cfr13I GGNCC 1 cut(s) 133
DdeI CTNAG 9 cut(s) 75, 84, 126, 147, 156, 198, 207, 249, 291
EaeI YGGCCR 1 cut(s) 276
Eam1104I CTCTTC 1 cut(s) 102
EarI CTCTTC 1 cut(s) 102
Eco57I CTGAAG 1 cut(s) 126
EcoO109I RGGNCCY 1 cut(s) 133
EcoRII CCWGG 4 cut(s) 41, 164, 215, 257
Fnu4HI GCNGC 7 cut(s) 12, 63, 93, 114, 186, 237, 279
Fsp4HI GCNGC 7 cut(s) 12, 63, 93, 114, 186, 237, 279
GluI GCNGC 7 cut(s) 12, 63, 93, 114, 186, 237, 279
GsuI CTGGAG 5 cut(s) 87, 117, 138, 210, 321
HaeIII GGCC 8 cut(s) 41, 92, 134, 164, 185, 236, 257, 278
HapII CCGG 1 cut(s) 138
HinfI GANTC 1 cut(s) 212
HpaII CCGG 1 cut(s) 138
Hpy188III TCNNGA 1 cut(s) 149
HpyCH4III ACNGT 1 cut(s) 274
HpyCH4V TGCA 1 cut(s) 14
HpyF10VI GCNNNNNNNGC 7 cut(s) 17, 47, 89, 161, 170, 236, 263
HpyF3I CTNAG 9 cut(s) 75, 84, 126, 147, 156, 198, 207, 249, 291
Lsp1109I GCAGC 2 cut(s) 49, 100
MaeIII GTNAC 1 cut(s) 268
MboII GAAGA 1 cut(s) 119
MhlI GDGCHC 1 cut(s) 22
MlyI GAGTC 1 cut(s) 221
MspA1I CMGCKG 2 cut(s) 95, 188
MspI CCGG 1 cut(s) 138
MspR9I CCNGG 5 cut(s) 43, 138, 166, 217, 259
MvaI CCWGG 4 cut(s) 43, 166, 217, 259
MwoI GCNNNNNNNGC 7 cut(s) 17, 47, 89, 161, 170, 236, 263
NciI CCSGG 1 cut(s) 138
NlaIV GGNNCC 1 cut(s) 135
PkrI GCNGC 7 cut(s) 13, 64, 94, 115, 187, 238, 280
PleI GAGTC 1 cut(s) 220
PpsI GAGTC 1 cut(s) 220
Psp6I CCWGG 4 cut(s) 41, 164, 215, 257
PspGI CCWGG 4 cut(s) 41, 164, 215, 257
PspN4I GGNNCC 1 cut(s) 135
PspPI GGNCC 1 cut(s) 133
SatI GCNGC 7 cut(s) 12, 63, 93, 114, 186, 237, 279
Sau96I GGNCC 1 cut(s) 133
SchI GAGTC 1 cut(s) 221
ScrFI CCNGG 5 cut(s) 43, 138, 166, 217, 259
SduI GDGCHC 1 cut(s) 22
SetI ASST 2 cut(s) 33, 208
SsiI CCGC 5 cut(s) 93, 186, 230, 237, 279
StyD4I CCNGG 5 cut(s) 41, 136, 164, 215, 257
TaaI ACNGT 1 cut(s) 274
TaqI TCGA 1 cut(s) 315
TauI GCSGC 4 cut(s) 95, 188, 239, 281
TscAI CASTG 5 cut(s) 27, 79, 109, 253, 295
TseI GCWGC 3 cut(s) 11, 62, 113
TspRI CASTG 5 cut(s) 27, 79, 109, 253, 295
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.