Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8291115.1

Orthogroup ID

OG0011558

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 493

Gene Structure 492 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8291115.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 492 bp

atggatccgaaggtccttacttacgaaagtgttgtgctgagaatgagcgacttggcactgcttagaggcccacattacttgaacgattgcataattgaattctatttcagttatctttcttccctttgtgatgatgacatccttctggtttcacctacagtctcattttggctagcaaattctcagaattcggaagctaattttagagacttcgaggagtctaatcaacttggtgaaaagcaagttgtgatattcacggtgaatgataatcaagacatgagccaaaatgatggcggaaaccattggagtttgctggtgtattacagaaaatccaatgcatttgtgcattacgacagcttggggggtttgaatagcttggttgccaggaagttttacggagcagttaagaaatatgtggcagctgcagcaacacaaacaccaacggttgggactaatagtttggttgacaccactaggtctattatcggcaag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Peptidase_C48 WRKY

Protein Analysis

164

Amino Acids

18.38

Weight (kDa)

5.05

Isoelectric Point (pI)

41.78

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011558)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_4g37251 FvH4_6g48790
malus_domestica	MD00G1127100.v1.1
prunus_persica	Prupe.1G350400_v2.0.a1 Prupe.1G350400_v2.0.a1
pyrus_communis	pycom16g00110
rosa_chinensis	RchiOBHm_Chr4g0447061
rosa_laevigata	RLG00000005608 RLG00000021798
rosa_multiflora	Rmu_co8291115.1_g000001 Rmu_co8439157.1_g000001 Rmu_sc0014071.1_g000004
rosa_roxburghii	Rroxscaffold_2G00082780 Rroxscaffold_5G00387380
rosa_rugosa	Rorug02G0534400
rosa_samantha	Rh2AG605300 Rh4BG448000 Rh4CG465100 Rh4DG446500
rosa_wichuraiana	Rw4G037550

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	446
AciI	CCGC	1 cut(s)	294
AclWI	GGATC	1 cut(s)	12
AcsI	RAATTY	3 cut(s)	98, 178, 187
AfiI	CCNNNNNNNGG	1 cut(s)	446
AgsI	TTSAA	3 cut(s)	82, 98, 370
AjnI	CCWGG	1 cut(s)	383
AluBI	AGCT	4 cut(s)	197, 357, 375, 422
AluI	AGCT	4 cut(s)	197, 357, 375, 422
Alw26I	GTCTC	2 cut(s)	166, 201
AlwI	GGATC	1 cut(s)	12
AoxI	GGCC	1 cut(s)	67
ApeKI	GCWGC	3 cut(s)	419, 422, 425
ApoI	RAATTY	3 cut(s)	98, 178, 187
ArsI	GACNNNNNNTTYG	2 cut(s)	442, 474
AspS9I	GGNCC	2 cut(s)	13, 68
AsuHPI	GGTGA	3 cut(s)	144, 245, 271
AsuNHI	GCTAGC	1 cut(s)	172
AvaII	GGWCC	1 cut(s)	13
BamHI	GGATCC	1 cut(s)	4
BbvI	GCAGC	3 cut(s)	409, 431, 437
BccI	CCATC	1 cut(s)	284
BciT130I	CCWGG	1 cut(s)	385
BcoDI	GTCTC	2 cut(s)	166, 201
BfaI	CTAG	2 cut(s)	173, 474
BfmI	CTRYAG	2 cut(s)	156, 423
BisI	GCNGC	3 cut(s)	420, 423, 426
BlsI	GCNGC	3 cut(s)	421, 424, 427
Bme1390I	CCNGG	1 cut(s)	385
Bme18I	GGWCC	1 cut(s)	13
BmgT120I	GGNCC	2 cut(s)	13, 68
BmiI	GGNNCC	1 cut(s)	6
BmrFI	CCNGG	1 cut(s)	385
BmtI	GCTAGC	1 cut(s)	176
Bsc4I	CCNNNNNNNGG	1 cut(s)	446
BseBI	CCWGG	1 cut(s)	385
BseGI	GGATG	1 cut(s)	138
BseLI	CCNNNNNNNGG	1 cut(s)	446
BseMII	CTCAG	2 cut(s)	29, 197
BseRI	GAGGAG	1 cut(s)	230
BseXI	GCAGC	3 cut(s)	409, 431, 437
BshFI	GGCC	1 cut(s)	69
BslFI	GGGAC	1 cut(s)	463
BslI	CCNNNNNNNGG	1 cut(s)	446
BsmAI	GTCTC	2 cut(s)	166, 201
BsmFI	GGGAC	1 cut(s)	463
BsnI	GGCC	1 cut(s)	69
Bsp143I	GATC	1 cut(s)	4
BspACI	CCGC	1 cut(s)	294
BspANI	GGCC	1 cut(s)	69
BspCNI	CTCAG	2 cut(s)	30, 196
BspLI	GGNNCC	1 cut(s)	6
BspMAI	CTGCAG	1 cut(s)	427
BspOI	GCTAGC	1 cut(s)	176
BspPI	GGATC	1 cut(s)	12
BssMI	GATC	1 cut(s)	4
Bst2UI	CCWGG	1 cut(s)	385
Bst4CI	ACNGT	3 cut(s)	160, 259, 445
BstC8I	GCNNGC	1 cut(s)	174
BstDEI	CTNAG	3 cut(s)	38, 62, 183
BstF5I	GGATG	1 cut(s)	138
BstKTI	GATC	1 cut(s)	7
BstMAI	GTCTC	2 cut(s)	166, 201
BstMBI	GATC	1 cut(s)	4
BstMWI	GCNNNNNNNGC	1 cut(s)	425
BstNI	CCWGG	1 cut(s)	385
BstSCI	CCNGG	1 cut(s)	383
BstSFI	CTRYAG	2 cut(s)	156, 423
BstV1I	GCAGC	3 cut(s)	409, 431, 437
BstX2I	RGATCY	1 cut(s)	4
BstXI	CCANNNNNNTGG	1 cut(s)	290
BstYI	RGATCY	1 cut(s)	4
BsuRI	GGCC	1 cut(s)	69
BtsCI	GGATG	1 cut(s)	138
BtsI	GCAGTG	1 cut(s)	56
BtsIMutI	CAGTG	1 cut(s)	56
Cac8I	GCNNGC	1 cut(s)	174
Cfr13I	GGNCC	2 cut(s)	13, 68
CspCI	CAANNNNNGTGG	2 cut(s)	60, 95
CviAII	CATG	1 cut(s)	277
CviJI	RGCY	7 cut(s)	69, 172, 197, 282, 357, 375, 422
CviKI_1	RGCY	7 cut(s)	69, 172, 197, 282, 357, 375, 422
DdeI	CTNAG	3 cut(s)	38, 62, 183
DpnI	GATC	1 cut(s)	6
DpnII	GATC	1 cut(s)	4
EciI	GGCGGA	1 cut(s)	309
Eco47I	GGWCC	1 cut(s)	13
EcoO109I	RGGNCCY	1 cut(s)	13
EcoRI	GAATTC	2 cut(s)	98, 187
EcoRII	CCWGG	1 cut(s)	383
EcoT22I	ATGCAT	1 cut(s)	340
FaeI	CATG	1 cut(s)	280
FaiI	YATR	3 cut(s)	92, 278, 414
FaqI	GGGAC	1 cut(s)	463
FatI	CATG	1 cut(s)	276
Fnu4HI	GCNGC	3 cut(s)	420, 423, 426
FokI	GGATG	1 cut(s)	125
Fsp4HI	GCNGC	3 cut(s)	420, 423, 426
FspBI	CTAG	2 cut(s)	173, 474
GluI	GCNGC	3 cut(s)	420, 423, 426
HaeIII	GGCC	1 cut(s)	69
Hin1II	CATG	1 cut(s)	280
HincII	GTYRAC	1 cut(s)	466
HindII	GTYRAC	1 cut(s)	466
HinfI	GANTC	1 cut(s)	218
HphI	GGTGA	3 cut(s)	144, 245, 271
Hpy166II	GTNNAC	1 cut(s)	466
Hpy188I	TCNGA	3 cut(s)	9, 186, 193
Hpy188III	TCNNGA	1 cut(s)	272
Hpy8I	GTNNAC	1 cut(s)	466
HpyAV	CCTTC	2 cut(s)	4, 152
HpyCH4III	ACNGT	3 cut(s)	160, 259, 445
HpyCH4V	TGCA	4 cut(s)	90, 338, 346, 425
HpyF10VI	GCNNNNNNNGC	1 cut(s)	425
HpyF3I	CTNAG	3 cut(s)	38, 62, 183
Hsp92II	CATG	1 cut(s)	280
Kzo9I	GATC	1 cut(s)	4
LmnI	GCTCC	1 cut(s)	398
LpnPI	CCDG	4 cut(s)	131, 299, 370, 397
Lsp1109I	GCAGC	3 cut(s)	409, 431, 437
MaeI	CTAG	2 cut(s)	173, 474
MalI	GATC	1 cut(s)	6
MboI	GATC	1 cut(s)	4
MboII	GAAGA	1 cut(s)	111
MflI	RGATCY	1 cut(s)	4
MluCI	AATT	5 cut(s)	93, 98, 178, 187, 199
MlyI	GAGTC	1 cut(s)	227
MnlI	CCTC	2 cut(s)	59, 208
Mph1103I	ATGCAT	1 cut(s)	340
MseI	TTAA	1 cut(s)	405
MspA1I	CMGCKG	1 cut(s)	422
MspR9I	CCNGG	1 cut(s)	385
MvaI	CCWGG	1 cut(s)	385
MwoI	GCNNNNNNNGC	1 cut(s)	425
NdeII	GATC	1 cut(s)	4
NheI	GCTAGC	1 cut(s)	172
NlaIII	CATG	1 cut(s)	280
NlaIV	GGNNCC	1 cut(s)	6
NsiI	ATGCAT	1 cut(s)	340
PflMI	CCANNNNNTGG	1 cut(s)	446
PkrI	GCNGC	3 cut(s)	421, 424, 427
PleI	GAGTC	1 cut(s)	226
PpsI	GAGTC	1 cut(s)	226
PpuMI	RGGWCCY	1 cut(s)	13
Psp5II	RGGWCCY	1 cut(s)	13
Psp6I	CCWGG	1 cut(s)	383
PspGI	CCWGG	1 cut(s)	383
PspN4I	GGNNCC	1 cut(s)	6
PspPI	GGNCC	2 cut(s)	13, 68
PspPPI	RGGWCCY	1 cut(s)	13
PstI	CTGCAG	1 cut(s)	427
PsuI	RGATCY	1 cut(s)	4
PvuII	CAGCTG	1 cut(s)	422
SaqAI	TTAA	1 cut(s)	405
SatI	GCNGC	3 cut(s)	420, 423, 426
Sau3AI	GATC	1 cut(s)	4
Sau96I	GGNCC	2 cut(s)	13, 68
SchI	GAGTC	1 cut(s)	227
ScrFI	CCNGG	1 cut(s)	385
SetI	ASST	7 cut(s)	15, 157, 199, 359, 377, 424, 479
SfcI	CTRYAG	2 cut(s)	156, 423
SinI	GGWCC	1 cut(s)	13
Sse9I	AATT	5 cut(s)	93, 98, 178, 187, 199
SsiI	CCGC	1 cut(s)	294
SspMI	CTAG	2 cut(s)	173, 474
StyD4I	CCNGG	1 cut(s)	383
TaaI	ACNGT	3 cut(s)	160, 259, 445
TaqI	TCGA	1 cut(s)	213
TasI	AATT	5 cut(s)	93, 98, 178, 187, 199
Tru1I	TTAA	1 cut(s)	405
Tru9I	TTAA	1 cut(s)	405
TscAI	CASTG	1 cut(s)	63
TseI	GCWGC	3 cut(s)	419, 422, 425
TspGWI	ACGGA	1 cut(s)	411
TspRI	CASTG	1 cut(s)	63
Van91I	CCANNNNNTGG	1 cut(s)	446
VpaK11BI	GGWCC	1 cut(s)	13
XapI	RAATTY	3 cut(s)	98, 178, 187
XspI	CTAG	2 cut(s)	173, 474
Zsp2I	ATGCAT	1 cut(s)	340

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.