Rmu_co8299591.1_g000001

Alpha/beta hydrolase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8299591.1
OG0009251
Physical Location & Seq
Forward (+)
436 .. 805
370 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8299591.1_g000001.1.cds

Sequence Viewer

Length: 285 bp
atggatgagaaccaaaaacactttgttctggttcatggaacttgccatggatcatggtgttggtacaaaagcatcgccctactccggggcgctggtcacggtgtcactgctctggaccttggtgcttctgggatcaactccaagcaggtggacgagatcgcttcaatttgggattatgccaagccattgatggagttcatggcttctattcctcatgatgagaaggtcatactgcctatttgcctcattacagttctccaccaggaactctcatacaagaagtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0003674 GO:0003824 GO:0016787 GO:0016788 GO:0052689 GO:0080032
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Abhydrolase_1 Abhydrolase_6

Protein Analysis

94

Amino Acids

10.51

Weight (kDa)

6.26

Isoelectric Point (pI)

19.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 136
Acc36I ACCTGC 1 cut(s) 136
AclWI GGATC 2 cut(s) 58, 140
AfaI GTAC 1 cut(s) 65
AfiI CCNNNNNNNGG 2 cut(s) 84, 85
AgsI TTSAA 1 cut(s) 165
AjnI CCWGG 1 cut(s) 261
AlwI GGATC 2 cut(s) 58, 140
AspLEI GCGC 1 cut(s) 92
AspS9I GGNCC 1 cut(s) 115
AsuC2I CCSGG 1 cut(s) 86
AvaII GGWCC 1 cut(s) 115
BccI CCATC 1 cut(s) 184
BciT130I CCWGG 1 cut(s) 263
BcnI CCSGG 1 cut(s) 86
BfoI RGCGCY 1 cut(s) 93
BfuAI ACCTGC 1 cut(s) 136
Bme1390I CCNGG 2 cut(s) 86, 263
Bme18I GGWCC 1 cut(s) 115
BmgT120I GGNCC 1 cut(s) 115
BmrFI CCNGG 2 cut(s) 86, 263
BmsI GCATC 1 cut(s) 81
BpuMI CCSGG 1 cut(s) 86
BsaJI CCNNGG 3 cut(s) 46, 85, 118
Bsc4I CCNNNNNNNGG 2 cut(s) 84, 85
BseBI CCWGG 1 cut(s) 263
BseDI CCNNGG 3 cut(s) 46, 85, 118
BseGI GGATG 1 cut(s) 10
BseLI CCNNNNNNNGG 2 cut(s) 84, 85
BsiSI CCGG 1 cut(s) 85
BslI CCNNNNNNNGG 2 cut(s) 84, 85
Bsp143I GATC 3 cut(s) 50, 132, 156
Bsp19I CCATGG 1 cut(s) 46
BspHI TCATGA 1 cut(s) 214
BspMI ACCTGC 1 cut(s) 136
BspPI GGATC 2 cut(s) 58, 140
BssECI CCNNGG 3 cut(s) 46, 85, 118
BssMI GATC 3 cut(s) 50, 132, 156
BssT1I CCWWGG 2 cut(s) 46, 118
Bst2UI CCWGG 1 cut(s) 263
Bst4CI ACNGT 2 cut(s) 101, 253
BstDSI CCRYGG 1 cut(s) 46
BstF5I GGATG 1 cut(s) 10
BstH2I RGCGCY 1 cut(s) 93
BstHHI GCGC 1 cut(s) 92
BstKTI GATC 3 cut(s) 53, 135, 159
BstMBI GATC 3 cut(s) 50, 132, 156
BstNI CCWGG 1 cut(s) 263
BstSCI CCNGG 2 cut(s) 84, 261
BstXI CCANNNNNNTGG 1 cut(s) 148
BtgI CCRYGG 1 cut(s) 46
BtgZI GCGATG 1 cut(s) 58
BtsCI GGATG 1 cut(s) 10
BtsI GCAGTG 1 cut(s) 105
BtsIMutI CAGTG 1 cut(s) 105
BveI ACCTGC 1 cut(s) 136
CciI TCATGA 1 cut(s) 214
CfoI GCGC 1 cut(s) 92
Cfr13I GGNCC 1 cut(s) 115
Csp6I GTAC 1 cut(s) 64
CviAII CATG 5 cut(s) 35, 47, 54, 199, 215
CviJI RGCY 2 cut(s) 184, 203
CviKI_1 RGCY 2 cut(s) 184, 203
CviQI GTAC 1 cut(s) 64
DpnI GATC 3 cut(s) 52, 134, 158
DpnII GATC 3 cut(s) 50, 132, 156
Eco130I CCWWGG 2 cut(s) 46, 118
Eco47I GGWCC 1 cut(s) 115
EcoRII CCWGG 1 cut(s) 261
EcoT14I CCWWGG 2 cut(s) 46, 118
ErhI CCWWGG 2 cut(s) 46, 118
FaeI CATG 5 cut(s) 38, 50, 57, 202, 218
FaiI YATR 8 cut(s) 36, 48, 55, 177, 200, 216, 230, 274
FatI CATG 5 cut(s) 34, 46, 53, 198, 214
FokI GGATG 1 cut(s) 17
GlaI GCGC 1 cut(s) 91
HaeII RGCGCY 1 cut(s) 93
HapII CCGG 1 cut(s) 85
HhaI GCGC 1 cut(s) 92
Hin1II CATG 5 cut(s) 38, 50, 57, 202, 218
Hin6I GCGC 1 cut(s) 90
HinP1I GCGC 1 cut(s) 90
HpaII CCGG 1 cut(s) 85
Hpy166II GTNNAC 1 cut(s) 151
Hpy188III TCNNGA 2 cut(s) 113, 215
Hpy8I GTNNAC 1 cut(s) 151
HpyAV CCTTC 1 cut(s) 217
HpyCH4III ACNGT 2 cut(s) 101, 253
Hsp92II CATG 5 cut(s) 38, 50, 57, 202, 218
HspAI GCGC 1 cut(s) 90
Kzo9I GATC 3 cut(s) 50, 132, 156
LpnPI CCDG 8 cut(s) 14, 78, 98, 98, 114, 131, 248, 275
LweI GCATC 1 cut(s) 81
MaeIII GTNAC 2 cut(s) 95, 103
MalI GATC 3 cut(s) 52, 134, 158
MboI GATC 3 cut(s) 50, 132, 156
MluCI AATT 1 cut(s) 165
MnlI CCTC 2 cut(s) 222, 254
MspI CCGG 1 cut(s) 85
MspR9I CCNGG 2 cut(s) 86, 263
MvaI CCWGG 1 cut(s) 263
NciI CCSGG 1 cut(s) 86
NcoI CCATGG 1 cut(s) 46
NdeII GATC 3 cut(s) 50, 132, 156
NlaIII CATG 5 cut(s) 38, 50, 57, 202, 218
NmuCI GTSAC 2 cut(s) 95, 103
PagI TCATGA 1 cut(s) 214
PaqCI CACCTGC 1 cut(s) 136
Psp6I CCWGG 1 cut(s) 261
PspGI CCWGG 1 cut(s) 261
PspPI GGNCC 1 cut(s) 115
RsaI GTAC 1 cut(s) 65
RsaNI GTAC 1 cut(s) 64
Sau3AI GATC 3 cut(s) 50, 132, 156
Sau96I GGNCC 1 cut(s) 115
ScrFI CCNGG 2 cut(s) 86, 263
SetI ASST 3 cut(s) 120, 150, 228
SfaNI GCATC 1 cut(s) 81
SinI GGWCC 1 cut(s) 115
Sse9I AATT 1 cut(s) 165
StyD4I CCNGG 2 cut(s) 84, 261
StyI CCWWGG 2 cut(s) 46, 118
TaaI ACNGT 2 cut(s) 101, 253
TasI AATT 1 cut(s) 165
TscAI CASTG 1 cut(s) 112
TseFI GTSAC 2 cut(s) 95, 103
Tsp45I GTSAC 2 cut(s) 95, 103
TspDTI ATGAA 2 cut(s) 23, 187
TspRI CASTG 1 cut(s) 112
VpaK11BI GGWCC 1 cut(s) 115
XcmI CCANNNNNNNNNTGG 1 cut(s) 187
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.