Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8303041.1

Orthogroup ID

OG0005945

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 758

Gene Structure 758 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8303041.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 455 bp

atgaaagatggcacccaagttgcagtcaaaatgctttctccatcatcaactcaaggaccgagggagttccaaactgaggctgagctcctgatgagaatccatcacagaaatttggcatcatttattggatactgtgatgatgctgataacctggctcttatatatgagtacatggctaatgggaaccttaaagattatctctcagttaaaagctcaggtatgacttgggaattgagacttcacatcgccatagatgctgcacaagggctagagtacttacaccatggatgcaagccacctattgtacacagagatgtgaagactgccaacattctcttaagtgaaaacctggaagctaagatagcagattttggtctttctaaggttttttccaatgataatgaaaccgacgtggaaaccacagttatgggcacagcaggttatttagacccaga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

LRR_8 Malectin_like Pkinase Pkinase_Tyr

Protein Analysis

151

Amino Acids

16.76

Weight (kDa)

5.11

Isoelectric Point (pI)

24.04

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005945)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G29180 AT4G29180 AT4G29180 AT4G29450
fragaria_vesca	FvH4_1g06670 FvH4_1g06670
malus_domestica	MD02G1069800.v1.1 MD02G1071600.v1.1 MD02G1071800.v1.1
prunus_persica	Prupe.7G215900_v2.0.a1
pyrus_communis	pycom02g05560 pycom02g05570 pycom15g17770 pycom15g17780
rosa_chinensis	RchiOBHm_Chr2g0092421 RchiOBHm_Chr2g0092431
rosa_laevigata	RLG00000016310
rosa_multiflora	Rmu_co8303041.1_g000001 Rmu_sc0002503.1_g000001 Rmu_sc0002503.1_g000003 Rmu_sc0013752.1_g000002
rosa_roxburghii	Rroxscaffold_2G00149130
rosa_rugosa	Rorug02G0026200.1
rosa_samantha	Rh2AG072000 Rh2BG072500 Rh2CG073700
rosa_wichuraiana	Rw2G006060

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	428
AccB1I	GGYRCC	1 cut(s)	11
AcsI	RAATTY	1 cut(s)	109
AfaI	GTAC	3 cut(s)	170, 275, 306
AfiI	CCNNNNNNNGG	1 cut(s)	76
AflII	CTTAAG	1 cut(s)	337
AjiI	CACGTC	1 cut(s)	412
AjnI	CCWGG	2 cut(s)	150, 348
AluBI	AGCT	3 cut(s)	85, 213, 356
AluI	AGCT	3 cut(s)	85, 213, 356
Alw21I	GWGCWC	1 cut(s)	87
Alw26I	GTCTC	1 cut(s)	229
ApeKI	GCWGC	1 cut(s)	257
ApoI	RAATTY	1 cut(s)	109
AspS9I	GGNCC	1 cut(s)	56
AvaII	GGWCC	1 cut(s)	56
BaeGI	GKGCMC	1 cut(s)	434
BanI	GGYRCC	1 cut(s)	11
BanII	GRGCYC	1 cut(s)	87
BbsI	GAAGAC	1 cut(s)	326
Bbv12I	GWGCWC	1 cut(s)	87
BbvI	GCAGC	1 cut(s)	244
BccI	CCATC	3 cut(s)	2, 49, 108
BciT130I	CCWGG	2 cut(s)	152, 350
BciVI	GTATCC	1 cut(s)	122
BcoDI	GTCTC	1 cut(s)	229
BfaI	CTAG	1 cut(s)	269
BfrI	CTTAAG	1 cut(s)	337
BfuAI	ACCTGC	1 cut(s)	428
BfuI	GTATCC	1 cut(s)	122
BisI	GCNGC	1 cut(s)	258
BlpI	GCTNAGC	1 cut(s)	81
BlsI	GCNGC	1 cut(s)	259
BmcAI	AGTACT	1 cut(s)	275
Bme1390I	CCNGG	2 cut(s)	152, 350
Bme18I	GGWCC	1 cut(s)	56
BmgBI	CACGTC	1 cut(s)	412
BmgT120I	GGNCC	1 cut(s)	56
BmiI	GGNNCC	2 cut(s)	13, 185
BmrFI	CCNGG	2 cut(s)	152, 350
BmsI	GCATC	4 cut(s)	125, 130, 244, 278
BpiI	GAAGAC	1 cut(s)	326
Bpu10I	CCTNAGC	1 cut(s)	214
Bpu1102I	GCTNAGC	1 cut(s)	81
BpuEI	CTTGAG	1 cut(s)	36
BsaBI	GATNNNNATC	1 cut(s)	95
BsaJI	CCNNGG	2 cut(s)	59, 283
Bsc4I	CCNNNNNNNGG	1 cut(s)	76
Bse8I	GATNNNNATC	1 cut(s)	95
BseBI	CCWGG	2 cut(s)	152, 350
BseDI	CCNNGG	2 cut(s)	59, 283
BseGI	GGATG	1 cut(s)	293
BseJI	GATNNNNATC	1 cut(s)	95
BseLI	CCNNNNNNNGG	1 cut(s)	76
BseMII	CTCAG	4 cut(s)	66, 72, 216, 228
BseSI	GKGCMC	1 cut(s)	434
BseXI	GCAGC	1 cut(s)	244
BsgI	GTGCAG	1 cut(s)	243
BshNI	GGYRCC	1 cut(s)	11
BsiHKAI	GWGCWC	1 cut(s)	87
BslI	CCNNNNNNNGG	1 cut(s)	76
BsmAI	GTCTC	1 cut(s)	229
Bsp1286I	GDGCHC	2 cut(s)	87, 434
Bsp1407I	TGTACA	1 cut(s)	304
Bsp1720I	GCTNAGC	1 cut(s)	81
Bsp19I	CCATGG	1 cut(s)	283
BspCNI	CTCAG	4 cut(s)	67, 73, 215, 227
BspLI	GGNNCC	2 cut(s)	13, 185
BspMI	ACCTGC	1 cut(s)	428
BspT107I	GGYRCC	1 cut(s)	11
BspTI	CTTAAG	1 cut(s)	337
BsrGI	TGTACA	1 cut(s)	304
BssECI	CCNNGG	2 cut(s)	59, 283
BssT1I	CCWWGG	1 cut(s)	283
Bst2UI	CCWGG	2 cut(s)	152, 350
Bst4CI	ACNGT	2 cut(s)	134, 424
BstAFI	CTTAAG	1 cut(s)	337
BstAUI	TGTACA	1 cut(s)	304
BstC8I	GCNNGC	1 cut(s)	293
BstDEI	CTNAG	6 cut(s)	75, 81, 202, 214, 357, 381
BstDSI	CCRYGG	1 cut(s)	283
BstF5I	GGATG	1 cut(s)	293
BstMAI	GTCTC	1 cut(s)	229
BstMWI	GCNNNNNNNGC	2 cut(s)	254, 362
BstNI	CCWGG	2 cut(s)	152, 350
BstSCI	CCNGG	2 cut(s)	150, 348
BstSLI	GKGCMC	1 cut(s)	434
BstV1I	GCAGC	1 cut(s)	244
BstV2I	GAAGAC	1 cut(s)	326
BstXI	CCANNNNNNTGG	1 cut(s)	427
BsuI	GTATCC	1 cut(s)	122
BtgI	CCRYGG	1 cut(s)	283
BtgZI	GCGATG	1 cut(s)	229
BtrI	CACGTC	1 cut(s)	412
BtsCI	GGATG	1 cut(s)	293
BveI	ACCTGC	1 cut(s)	428
Cac8I	GCNNGC	1 cut(s)	293
Cfr13I	GGNCC	1 cut(s)	56
Csp6I	GTAC	3 cut(s)	169, 274, 305
CviAII	CATG	2 cut(s)	172, 284
CviJI	RGCY	8 cut(s)	80, 85, 155, 176, 213, 268, 295, 356
CviKI_1	RGCY	8 cut(s)	80, 85, 155, 176, 213, 268, 295, 356
CviQI	GTAC	3 cut(s)	169, 274, 305
DdeI	CTNAG	6 cut(s)	75, 81, 202, 214, 357, 381
Ecl136II	GAGCTC	1 cut(s)	85
Eco130I	CCWWGG	1 cut(s)	283
Eco24I	GRGCYC	1 cut(s)	87
Eco47I	GGWCC	1 cut(s)	56
Eco53kI	GAGCTC	1 cut(s)	85
EcoICRI	GAGCTC	1 cut(s)	85
EcoRII	CCWGG	2 cut(s)	150, 348
EcoT14I	CCWWGG	1 cut(s)	283
EcoT38I	GRGCYC	1 cut(s)	87
ErhI	CCWWGG	1 cut(s)	283
FaeI	CATG	2 cut(s)	175, 287
FaiI	YATR	8 cut(s)	161, 163, 165, 173, 221, 251, 285, 428
FatI	CATG	2 cut(s)	171, 283
Fnu4HI	GCNGC	1 cut(s)	258
FokI	GGATG	1 cut(s)	300
FriOI	GRGCYC	1 cut(s)	87
Fsp4HI	GCNGC	1 cut(s)	258
FspBI	CTAG	1 cut(s)	269
GluI	GCNGC	1 cut(s)	258
Hin1II	CATG	2 cut(s)	175, 287
HinfI	GANTC	1 cut(s)	96
Hpy166II	GTNNAC	1 cut(s)	307
Hpy188III	TCNNGA	1 cut(s)	88
Hpy8I	GTNNAC	1 cut(s)	307
Hpy99I	CGWCG	1 cut(s)	413
HpyCH4III	ACNGT	2 cut(s)	134, 424
HpyCH4IV	ACGT	1 cut(s)	411
HpyCH4V	TGCA	3 cut(s)	23, 260, 291
HpyF10VI	GCNNNNNNNGC	2 cut(s)	254, 362
HpyF3I	CTNAG	6 cut(s)	75, 81, 202, 214, 357, 381
HpySE526I	ACGT	1 cut(s)	411
Hsp92II	CATG	2 cut(s)	175, 287
LmnI	GCTCC	1 cut(s)	90
LpnPI	CCDG	7 cut(s)	101, 137, 164, 201, 335, 362, 423
Lsp1109I	GCAGC	1 cut(s)	244
LweI	GCATC	4 cut(s)	125, 130, 244, 278
MaeI	CTAG	1 cut(s)	269
MaeII	ACGT	1 cut(s)	411
MboII	GAAGA	1 cut(s)	331
MhlI	GDGCHC	2 cut(s)	87, 434
MluCI	AATT	2 cut(s)	109, 230
MnlI	CCTC	2 cut(s)	54, 70
MseI	TTAA	3 cut(s)	189, 207, 338
MslI	CAYNNNNRTG	2 cut(s)	312, 425
MspCI	CTTAAG	1 cut(s)	337
MspR9I	CCNGG	2 cut(s)	152, 350
MvaI	CCWGG	2 cut(s)	152, 350
MwoI	GCNNNNNNNGC	2 cut(s)	254, 362
NcoI	CCATGG	1 cut(s)	283
NlaIII	CATG	2 cut(s)	175, 287
NlaIV	GGNNCC	2 cut(s)	13, 185
PfeI	GAWTC	1 cut(s)	96
PkrI	GCNGC	1 cut(s)	259
Psp124BI	GAGCTC	1 cut(s)	87
Psp6I	CCWGG	2 cut(s)	150, 348
PspGI	CCWGG	2 cut(s)	150, 348
PspN4I	GGNNCC	2 cut(s)	13, 185
PspPI	GGNCC	1 cut(s)	56
RsaI	GTAC	3 cut(s)	170, 275, 306
RsaNI	GTAC	3 cut(s)	169, 274, 305
RseI	CAYNNNNRTG	2 cut(s)	312, 425
SacI	GAGCTC	1 cut(s)	87
SaqAI	TTAA	3 cut(s)	189, 207, 338
SatI	GCNGC	1 cut(s)	258
Sau96I	GGNCC	1 cut(s)	56
ScaI	AGTACT	1 cut(s)	275
ScrFI	CCNGG	2 cut(s)	152, 350
SduI	GDGCHC	2 cut(s)	87, 434
SfaNI	GCATC	4 cut(s)	125, 130, 244, 278
SinI	GGWCC	1 cut(s)	56
SmiMI	CAYNNNNRTG	2 cut(s)	312, 425
SmlI	CTYRAG	2 cut(s)	51, 337
SmoI	CTYRAG	2 cut(s)	51, 337
Sse9I	AATT	2 cut(s)	109, 230
SspMI	CTAG	1 cut(s)	269
SstI	GAGCTC	1 cut(s)	87
StyD4I	CCNGG	2 cut(s)	150, 348
StyI	CCWWGG	1 cut(s)	283
TaaI	ACNGT	2 cut(s)	134, 424
TaiI	ACGT	1 cut(s)	414
TaqII	GACCGA	1 cut(s)	73
TasI	AATT	2 cut(s)	109, 230
TatI	WGTACW	3 cut(s)	168, 273, 304
TfiI	GAWTC	1 cut(s)	96
Tru1I	TTAA	3 cut(s)	189, 207, 338
Tru9I	TTAA	3 cut(s)	189, 207, 338
TseI	GCWGC	1 cut(s)	257
TspDTI	ATGAA	2 cut(s)	17, 417
Vha464I	CTTAAG	1 cut(s)	337
VpaK11BI	GGWCC	1 cut(s)	56
XapI	RAATTY	1 cut(s)	109
XspI	CTAG	1 cut(s)	269
ZrmI	AGTACT	1 cut(s)	275

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.