Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8308117.1

Orthogroup ID

OG0007620

Physical Location & Seq

Genomic Coordinates Forward (+)

397 .. 873

Gene Structure 477 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8308117.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 381 bp

atggctagctcactggtgctgattttcagtctggtcctcactgcattggaaagcttcggcacccagcaggtcgaggctcgtgcctttttcgtgttcggagactccttggtcgacaatggcaacaacaattacttgctaacccaggctcgtgccgacgcttatccttatggcattgactatccaactggtcgaccaacgggccgtttctccaatggctacaacatccctgacttcatcagtcaagcacttggtgcagaatccacgttgccttacttgagtccagagctcaccggacaaaggctacttgttggtgccaactttgcttctgctggcattggaatcctcaatgacaccggaattcagtttgtaagttttatttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Lipase_GDSL

Protein Analysis

126

Amino Acids

13.51

Weight (kDa)

4.24

Isoelectric Point (pI)

14.41

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007620)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G18430
fragaria_vesca	FvH4_6g01380 FvH4_6g01380 FvH4_6g01380
malus_domestica	MD04G1234400.v1.1 MD04G1234500.v1.1 MD04G1234700.v1.1 MD12G1252500.v1.1
prunus_persica	Prupe.6G354200_v2.0.a1
pyrus_communis	pycom04g20810 pycom04g20840 pycom04g20850 pycom12g23190
rosa_chinensis	RchiOBHm_Chr3g0448961
rosa_laevigata	RLG00000025863
rosa_multiflora	Rmu_co8308117.1_g000001 Rmu_sc0003116.1_g000014
rosa_roxburghii	Rroxscaffold_6G00427130
rosa_rugosa	Rorug02G0617300
rosa_samantha	Rh3AG015800 Rh3BG015900 Rh3CG014900 Rh3DG016200
rosa_wichuraiana	Rw3G001180

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	107
Acc36I	ACCTGC	1 cut(s)	58
AccB1I	GGYRCC	2 cut(s)	59, 311
AccI	GTMKAC	2 cut(s)	111, 190
AcsI	RAATTY	1 cut(s)	357
AdeI	CACNNNGTG	1 cut(s)	251
AfiI	CCNNNNNNNGG	1 cut(s)	297
AjnI	CCWGG	1 cut(s)	141
AluBI	AGCT	3 cut(s)	9, 54, 286
AluI	AGCT	3 cut(s)	9, 54, 286
Alw21I	GWGCWC	1 cut(s)	288
Alw26I	GTCTC	1 cut(s)	93
AoxI	GGCC	1 cut(s)	199
ApoI	RAATTY	1 cut(s)	357
AspS9I	GGNCC	2 cut(s)	34, 199
AsuHPI	GGTGA	1 cut(s)	280
AsuNHI	GCTAGC	1 cut(s)	5
AvaII	GGWCC	1 cut(s)	34
BanI	GGYRCC	2 cut(s)	59, 311
BanII	GRGCYC	1 cut(s)	288
BauI	CACGAG	2 cut(s)	78, 147
Bbv12I	GWGCWC	1 cut(s)	288
BceAI	ACGGC	1 cut(s)	186
BcgI	CGANNNNNNTGC	2 cut(s)	62, 96
BciT130I	CCWGG	1 cut(s)	143
BcoDI	GTCTC	1 cut(s)	93
BfaI	CTAG	1 cut(s)	6
BfuAI	ACCTGC	1 cut(s)	58
Bme1390I	CCNGG	1 cut(s)	143
Bme18I	GGWCC	1 cut(s)	34
BmgT120I	GGNCC	2 cut(s)	34, 199
BmiI	GGNNCC	2 cut(s)	61, 313
BmrFI	CCNGG	1 cut(s)	143
BmtI	GCTAGC	1 cut(s)	9
BpuEI	CTTGAG	1 cut(s)	295
BsaJI	CCNNGG	2 cut(s)	105, 141
BsaWI	WCCGGW	2 cut(s)	290, 353
Bsc4I	CCNNNNNNNGG	1 cut(s)	297
Bse1I	ACTGG	2 cut(s)	18, 190
BseBI	CCWGG	1 cut(s)	143
BseDI	CCNNGG	2 cut(s)	105, 141
BseGI	GGATG	1 cut(s)	222
BseLI	CCNNNNNNNGG	1 cut(s)	297
BseNI	ACTGG	2 cut(s)	18, 190
BseYI	CCCAGC	1 cut(s)	63
BsgI	GTGCAG	1 cut(s)	273
BshFI	GGCC	1 cut(s)	201
BshNI	GGYRCC	2 cut(s)	59, 311
BsiHKAI	GWGCWC	1 cut(s)	288
BsiSI	CCGG	2 cut(s)	291, 354
BslI	CCNNNNNNNGG	1 cut(s)	297
BsmAI	GTCTC	1 cut(s)	93
BsnI	GGCC	1 cut(s)	201
Bsp1286I	GDGCHC	1 cut(s)	288
BspANI	GGCC	1 cut(s)	201
BspLI	GGNNCC	2 cut(s)	61, 313
BspMI	ACCTGC	1 cut(s)	58
BspOI	GCTAGC	1 cut(s)	9
BspT107I	GGYRCC	2 cut(s)	59, 311
BsrI	ACTGG	2 cut(s)	18, 190
BssECI	CCNNGG	2 cut(s)	105, 141
BssSI	CACGAG	2 cut(s)	78, 147
BssT1I	CCWWGG	1 cut(s)	105
Bst2BI	CACGAG	2 cut(s)	78, 147
Bst2UI	CCWGG	1 cut(s)	143
BstAPI	GCANNNNNTGC	1 cut(s)	251
BstC8I	GCNNGC	2 cut(s)	7, 331
BstF5I	GGATG	1 cut(s)	222
BstMAI	GTCTC	1 cut(s)	93
BstMWI	GCNNNNNNNGC	2 cut(s)	251, 320
BstNI	CCWGG	1 cut(s)	143
BstSCI	CCNGG	1 cut(s)	141
BsuRI	GGCC	1 cut(s)	201
BtsCI	GGATG	1 cut(s)	222
BtsI	GCAGTG	1 cut(s)	39
BtsIMutI	CAGTG	2 cut(s)	11, 39
BveI	ACCTGC	1 cut(s)	58
Cac8I	GCNNGC	2 cut(s)	7, 331
Cfr13I	GGNCC	2 cut(s)	34, 199
CseI	GACGC	1 cut(s)	164
CviJI	RGCY	9 cut(s)	5, 9, 54, 77, 146, 201, 216, 286, 301
CviKI_1	RGCY	9 cut(s)	5, 9, 54, 77, 146, 201, 216, 286, 301
DraIII	CACNNNGTG	1 cut(s)	251
DrdI	GACNNNNNNGTC	1 cut(s)	107
DseDI	GACNNNNNNGTC	1 cut(s)	107
Ecl136II	GAGCTC	1 cut(s)	286
Eco130I	CCWWGG	1 cut(s)	105
Eco24I	GRGCYC	1 cut(s)	288
Eco47I	GGWCC	1 cut(s)	34
Eco53kI	GAGCTC	1 cut(s)	286
EcoICRI	GAGCTC	1 cut(s)	286
EcoRI	GAATTC	1 cut(s)	357
EcoRII	CCWGG	1 cut(s)	141
EcoT14I	CCWWGG	1 cut(s)	105
EcoT38I	GRGCYC	1 cut(s)	288
ErhI	CCWWGG	1 cut(s)	105
FaiI	YATR	1 cut(s)	168
FblI	GTMKAC	2 cut(s)	111, 190
FokI	GGATG	1 cut(s)	209
FriOI	GRGCYC	1 cut(s)	288
FspBI	CTAG	1 cut(s)	6
GsaI	CCCAGC	1 cut(s)	67
HaeIII	GGCC	1 cut(s)	201
HapII	CCGG	2 cut(s)	291, 354
HgaI	GACGC	1 cut(s)	164
HincII	GTYRAC	2 cut(s)	112, 191
HindII	GTYRAC	2 cut(s)	112, 191
HindIII	AAGCTT	1 cut(s)	52
HinfI	GANTC	4 cut(s)	101, 257, 277, 339
HpaII	CCGG	2 cut(s)	291, 354
HphI	GGTGA	1 cut(s)	280
Hpy166II	GTNNAC	2 cut(s)	112, 191
Hpy188I	TCNGA	1 cut(s)	98
Hpy188III	TCNNGA	1 cut(s)	281
Hpy8I	GTNNAC	2 cut(s)	112, 191
Hpy99I	CGWCG	1 cut(s)	158
HpyCH4IV	ACGT	1 cut(s)	263
HpyCH4V	TGCA	2 cut(s)	44, 254
HpyF10VI	GCNNNNNNNGC	2 cut(s)	251, 320
HpySE526I	ACGT	1 cut(s)	263
MaeI	CTAG	1 cut(s)	6
MaeII	ACGT	1 cut(s)	263
MhlI	GDGCHC	1 cut(s)	288
MluCI	AATT	2 cut(s)	127, 357
MlyI	GAGTC	2 cut(s)	95, 286
MmeI	TCCRAC	1 cut(s)	206
MnlI	CCTC	3 cut(s)	47, 67, 353
MspI	CCGG	2 cut(s)	291, 354
MspR9I	CCNGG	1 cut(s)	143
MvaI	CCWGG	1 cut(s)	143
MwoI	GCNNNNNNNGC	2 cut(s)	251, 320
NheI	GCTAGC	1 cut(s)	5
NlaIV	GGNNCC	2 cut(s)	61, 313
PfeI	GAWTC	2 cut(s)	257, 339
PleI	GAGTC	2 cut(s)	95, 285
PpsI	GAGTC	2 cut(s)	95, 285
Psp124BI	GAGCTC	1 cut(s)	288
Psp6I	CCWGG	1 cut(s)	141
PspFI	CCCAGC	1 cut(s)	63
PspGI	CCWGG	1 cut(s)	141
PspN4I	GGNNCC	2 cut(s)	61, 313
PspPI	GGNCC	2 cut(s)	34, 199
SacI	GAGCTC	1 cut(s)	288
SalI	GTCGAC	2 cut(s)	110, 189
Sau96I	GGNCC	2 cut(s)	34, 199
SchI	GAGTC	2 cut(s)	95, 286
ScrFI	CCNGG	1 cut(s)	143
SduI	GDGCHC	1 cut(s)	288
SetI	ASST	5 cut(s)	11, 56, 72, 266, 288
SinI	GGWCC	1 cut(s)	34
SmlI	CTYRAG	1 cut(s)	274
SmoI	CTYRAG	1 cut(s)	274
Sse9I	AATT	2 cut(s)	127, 357
SspMI	CTAG	1 cut(s)	6
SstI	GAGCTC	1 cut(s)	288
StyD4I	CCNGG	1 cut(s)	141
StyI	CCWWGG	1 cut(s)	105
TaiI	ACGT	1 cut(s)	266
TaqI	TCGA	3 cut(s)	72, 111, 190
TasI	AATT	2 cut(s)	127, 357
TfiI	GAWTC	2 cut(s)	257, 339
TscAI	CASTG	2 cut(s)	18, 46
TspDTI	ATGAA	1 cut(s)	223
TspRI	CASTG	2 cut(s)	18, 46
VpaK11BI	GGWCC	1 cut(s)	34
XapI	RAATTY	1 cut(s)	357
XmiI	GTMKAC	2 cut(s)	111, 190
XspI	CTAG	1 cut(s)	6

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.