Rmu_sc0003116.1_g000014

Belongs to the 'GDSL' lipolytic enzyme family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003116.1
Physical Location & Seq
Forward (+)
71881 .. 73668
1788 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003116.1_g000014.1.cds

Sequence Viewer

Length: 1095 bp
atggctagctcactggtgctgattttcagtctggtcctcactgcattggaaagcttcggcacccagcaggtcgaggctcgtgcctttttcgtgttcggagactccttggtcgacaatggcaacaacaattacttgctaacccaggctcgtgccgacgcttatccttatggcattgactatccaactggtcgaccaacgggccgtttctccaatggctacaacatccctgacttcatcagtcaagcacttggtgcagaatccacgttgccttacttgagtccagagctcaccggacaaaggctacttgttggtgccaactttgcttctgctggcattggaatcctcaatgacaccggaattcagtttgtaaacataatcagaatgtacagacaatttgagtattttcaagaataccagcaaagagtgagtgcccttatcggatctgaacgggcggagcaacttgtaagcggagcacttattctcatgactgttggcggcaacgactttgtcaacaattactacttggttccctactctgctagatctcgtcaatattctcttccagattatgtcgaatacctcatttctgagttcagaaaacttcttttgaggctatacgatcttggagggcgtagggttttggtgacaggtacaggaccattaggctgtgttccagctgagttggccacgagaagtacgaacggtcaatgctcagccgagctgcaaagagctgcaggtctctttaatccgcaacttactcagatgctaactggactcaacagggaactgggtgccgatatcttcattgctgctaacactcagcagagtgctagtgacttcgtggttaaccctcaagcatatggatttactacagcgaaaattgcctgctgcgggcaaggaccttacaatgggctgggattgtgcactggattgtccaatttgtgcccgaacagagacgtatatgctttctgggattcatttcatccatcagaaagggcaaaccggtacattgttcagaatattctgaccggcactactgaatacatgaaccccatgaacctcagcaccattttggctttggactccaggacctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

364

Amino Acids

39.97

Weight (kDa)

5.07

Isoelectric Point (pI)

31.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 107
Acc36I ACCTGC 2 cut(s) 58, 725
AccB1I GGYRCC 3 cut(s) 59, 311, 791
AccI GTMKAC 2 cut(s) 111, 190
AciI CCGC 5 cut(s) 452, 468, 495, 749, 891
AclWI GGATC 1 cut(s) 448
AcoI YGGCCR 1 cut(s) 684
AcsI RAATTY 1 cut(s) 357
AdeI CACNNNGTG 1 cut(s) 251
AfaI GTAC 4 cut(s) 386, 652, 697, 1007
AfiI CCNNNNNNNGG 3 cut(s) 297, 891, 908
AgeI ACCGGT 1 cut(s) 1002
AgsI TTSAA 1 cut(s) 407
AjnI CCWGG 2 cut(s) 141, 1085
AluBI AGCT 6 cut(s) 9, 54, 286, 677, 721, 731
AluI AGCT 6 cut(s) 9, 54, 286, 677, 721, 731
Alw21I GWGCWC 3 cut(s) 288, 475, 926
Alw26I GTCTC 3 cut(s) 93, 743, 948
Alw44I GTGCAC 1 cut(s) 922
AlwI GGATC 1 cut(s) 448
AoxI GGCC 2 cut(s) 199, 684
ApaLI GTGCAC 1 cut(s) 922
ApeKI GCWGC 4 cut(s) 721, 731, 809, 888
ApoI RAATTY 1 cut(s) 357
AsiGI ACCGGT 1 cut(s) 1002
AspS9I GGNCC 5 cut(s) 34, 199, 656, 899, 1089
AsuHPI GGTGA 2 cut(s) 280, 655
AsuNHI GCTAGC 1 cut(s) 5
AvaII GGWCC 4 cut(s) 34, 656, 899, 1089
BaeGI GKGCMC 3 cut(s) 433, 926, 947
BalI TGGCCA 1 cut(s) 686
BanI GGYRCC 3 cut(s) 59, 311, 791
BanII GRGCYC 1 cut(s) 288
BauI CACGAG 3 cut(s) 78, 147, 688
Bbv12I GWGCWC 3 cut(s) 288, 475, 926
BbvCI CCTCAGC 1 cut(s) 1061
BbvI GCAGC 4 cut(s) 708, 718, 796, 875
BccI CCATC 1 cut(s) 994
BceAI ACGGC 1 cut(s) 186
BcgI CGANNNNNNTGC 2 cut(s) 62, 96
BciT130I CCWGG 2 cut(s) 143, 1087
BcoDI GTCTC 3 cut(s) 93, 743, 948
BfaI CTAG 4 cut(s) 6, 540, 831, 1093
BfmI CTRYAG 2 cut(s) 732, 870
BfuAI ACCTGC 2 cut(s) 58, 725
BglII AGATCT 1 cut(s) 542
BisI GCNGC 5 cut(s) 496, 722, 732, 810, 889
BlpI GCTNAGC 1 cut(s) 712
BlsI GCNGC 5 cut(s) 497, 723, 733, 811, 890
Bme1390I CCNGG 2 cut(s) 143, 1087
Bme18I GGWCC 4 cut(s) 34, 656, 899, 1089
BmgT120I GGNCC 5 cut(s) 34, 199, 656, 899, 1089
BmiI GGNNCC 4 cut(s) 61, 313, 528, 793
BmrFI CCNGG 2 cut(s) 143, 1087
BmrI ACTGGG 1 cut(s) 797
BmsI GCATC 1 cut(s) 753
BmtI GCTAGC 1 cut(s) 9
BmuI ACTGGG 1 cut(s) 797
BpmI CTGGAG 1 cut(s) 1069
Bpu10I CCTNAGC 1 cut(s) 1061
Bpu1102I GCTNAGC 1 cut(s) 712
BpuEI CTTGAG 2 cut(s) 295, 837
BsaI GGTCTC 1 cut(s) 743
BsaJI CCNNGG 2 cut(s) 105, 141
BsaWI WCCGGW 3 cut(s) 290, 353, 1002
Bsc4I CCNNNNNNNGG 3 cut(s) 297, 891, 908
Bse118I RCCGGY 2 cut(s) 1002, 1028
Bse1I ACTGG 5 cut(s) 18, 190, 775, 792, 931
Bse3DI GCAATG 1 cut(s) 804
BseBI CCWGG 2 cut(s) 143, 1087
BseDI CCNNGG 2 cut(s) 105, 141
BseGI GGATG 2 cut(s) 222, 982
BseLI CCNNNNNNNGG 3 cut(s) 297, 891, 908
BseMI GCAATG 1 cut(s) 804
BseMII CTCAG 6 cut(s) 579, 669, 726, 773, 833, 1075
BseNI ACTGG 5 cut(s) 18, 190, 775, 792, 931
BseSI GKGCMC 3 cut(s) 433, 926, 947
BseXI GCAGC 4 cut(s) 708, 718, 796, 875
BseYI CCCAGC 2 cut(s) 63, 913
BsgI GTGCAG 1 cut(s) 273
BshFI GGCC 2 cut(s) 201, 686
BshNI GGYRCC 3 cut(s) 59, 311, 791
BshTI ACCGGT 1 cut(s) 1002
BsiHKAI GWGCWC 3 cut(s) 288, 475, 926
BsiSI CCGG 4 cut(s) 291, 354, 1003, 1029
BslI CCNNNNNNNGG 3 cut(s) 297, 891, 908
BsmAI GTCTC 3 cut(s) 93, 743, 948
BsmBI CGTCTC 1 cut(s) 948
BsnI GGCC 2 cut(s) 201, 686
Bso31I GGTCTC 1 cut(s) 743
Bsp1286I GDGCHC 5 cut(s) 288, 433, 475, 926, 947
Bsp1407I TGTACA 1 cut(s) 384
Bsp143I GATC 3 cut(s) 440, 542, 619
Bsp1720I GCTNAGC 1 cut(s) 712
BspACI CCGC 5 cut(s) 452, 468, 495, 749, 891
BspANI GGCC 2 cut(s) 201, 686
BspCNI CTCAG 6 cut(s) 580, 670, 725, 772, 832, 1074
BspHI TCATGA 1 cut(s) 483
BspLI GGNNCC 4 cut(s) 61, 313, 528, 793
BspMAI CTGCAG 1 cut(s) 736
BspMI ACCTGC 2 cut(s) 58, 725
BspOI GCTAGC 1 cut(s) 9
BspPI GGATC 1 cut(s) 448
BspT107I GGYRCC 3 cut(s) 59, 311, 791
BspTNI GGTCTC 1 cut(s) 743
BsrDI GCAATG 1 cut(s) 804
BsrFI RCCGGY 2 cut(s) 1002, 1028
BsrGI TGTACA 1 cut(s) 384
BsrI ACTGG 5 cut(s) 18, 190, 775, 792, 931
BssAI RCCGGY 2 cut(s) 1002, 1028
BssECI CCNNGG 2 cut(s) 105, 141
BssMI GATC 3 cut(s) 440, 542, 619
BssSI CACGAG 3 cut(s) 78, 147, 688
BssT1I CCWWGG 1 cut(s) 105
Bst2BI CACGAG 3 cut(s) 78, 147, 688
Bst2UI CCWGG 2 cut(s) 143, 1087
Bst4CI ACNGT 2 cut(s) 490, 704
Bst6I CTCTTC 1 cut(s) 564
BstAPI GCANNNNNTGC 1 cut(s) 251
BstAUI TGTACA 1 cut(s) 384
BstC8I GCNNGC 4 cut(s) 7, 331, 886, 893
BstDEI CTNAG 6 cut(s) 588, 678, 712, 759, 819, 1061
BstF5I GGATG 2 cut(s) 222, 982
BstKTI GATC 3 cut(s) 443, 545, 622
BstMAI GTCTC 3 cut(s) 93, 743, 948
BstMBI GATC 3 cut(s) 440, 542, 619
BstMWI GCNNNNNNNGC 4 cut(s) 251, 320, 683, 881
BstNI CCWGG 2 cut(s) 143, 1087
BstSCI CCNGG 2 cut(s) 141, 1085
BstSFI CTRYAG 2 cut(s) 732, 870
BstSLI GKGCMC 3 cut(s) 433, 926, 947
BstV1I GCAGC 4 cut(s) 708, 718, 796, 875
BstX2I RGATCY 2 cut(s) 440, 542
BstYI RGATCY 2 cut(s) 440, 542
BsuRI GGCC 2 cut(s) 201, 686
BtsCI GGATG 2 cut(s) 222, 982
BtsI GCAGTG 1 cut(s) 39
BtsIMutI CAGTG 3 cut(s) 11, 39, 924
BveI ACCTGC 2 cut(s) 58, 725
Cac8I GCNNGC 4 cut(s) 7, 331, 886, 893
CciI TCATGA 1 cut(s) 483
Cfr10I RCCGGY 2 cut(s) 1002, 1028
Cfr13I GGNCC 5 cut(s) 34, 199, 656, 899, 1089
CseI GACGC 1 cut(s) 164
Csp6I GTAC 4 cut(s) 385, 651, 696, 1006
CspAI ACCGGT 1 cut(s) 1002
CviAII CATG 3 cut(s) 484, 1045, 1054
CviQI GTAC 4 cut(s) 385, 651, 696, 1006
DdeI CTNAG 6 cut(s) 588, 678, 712, 759, 819, 1061
DpnI GATC 3 cut(s) 442, 544, 621
DpnII GATC 3 cut(s) 440, 542, 619
DraIII CACNNNGTG 1 cut(s) 251
DrdI GACNNNNNNGTC 1 cut(s) 107
DseDI GACNNNNNNGTC 1 cut(s) 107
EaeI YGGCCR 1 cut(s) 684
Eam1104I CTCTTC 1 cut(s) 564
EarI CTCTTC 1 cut(s) 564
EciI GGCGGA 1 cut(s) 467
Ecl136II GAGCTC 1 cut(s) 286
Eco130I CCWWGG 1 cut(s) 105
Eco24I GRGCYC 1 cut(s) 288
Eco31I GGTCTC 1 cut(s) 743
Eco32I GATATC 1 cut(s) 799
Eco47I GGWCC 4 cut(s) 34, 656, 899, 1089
Eco53kI GAGCTC 1 cut(s) 286
EcoICRI GAGCTC 1 cut(s) 286
EcoO109I RGGNCCY 2 cut(s) 899, 1089
EcoRI GAATTC 1 cut(s) 357
EcoRII CCWGG 2 cut(s) 141, 1085
EcoRV GATATC 1 cut(s) 799
EcoT14I CCWWGG 1 cut(s) 105
EcoT38I GRGCYC 1 cut(s) 288
ErhI CCWWGG 1 cut(s) 105
Esp3I CGTCTC 1 cut(s) 948
FaeI CATG 3 cut(s) 487, 1048, 1057
FatI CATG 3 cut(s) 483, 1044, 1053
FauI CCCGC 1 cut(s) 884
FauNDI CATATG 1 cut(s) 859
FblI GTMKAC 2 cut(s) 111, 190
Fnu4HI GCNGC 5 cut(s) 496, 722, 732, 810, 889
FokI GGATG 2 cut(s) 209, 969
FriOI GRGCYC 1 cut(s) 288
Fsp4HI GCNGC 5 cut(s) 496, 722, 732, 810, 889
FspBI CTAG 4 cut(s) 6, 540, 831, 1093
GluI GCNGC 5 cut(s) 496, 722, 732, 810, 889
GsaI CCCAGC 2 cut(s) 67, 917
GsuI CTGGAG 1 cut(s) 1069
HaeIII GGCC 2 cut(s) 201, 686
HapII CCGG 4 cut(s) 291, 354, 1003, 1029
HgaI GACGC 1 cut(s) 164
Hin1II CATG 3 cut(s) 487, 1048, 1057
HincII GTYRAC 4 cut(s) 112, 191, 511, 847
HindII GTYRAC 4 cut(s) 112, 191, 511, 847
HindIII AAGCTT 1 cut(s) 52
HinfI GANTC 7 cut(s) 101, 257, 277, 339, 774, 974, 1082
HpaI GTTAAC 1 cut(s) 847
HpaII CCGG 4 cut(s) 291, 354, 1003, 1029
HphI GGTGA 2 cut(s) 280, 655
Hpy166II GTNNAC 6 cut(s) 112, 191, 370, 511, 847, 924
Hpy188III TCNNGA 4 cut(s) 281, 407, 484, 563
Hpy8I GTNNAC 6 cut(s) 112, 191, 370, 511, 847, 924
Hpy99I CGWCG 1 cut(s) 158
HpyCH4III ACNGT 2 cut(s) 490, 704
HpyCH4IV ACGT 2 cut(s) 263, 957
HpyCH4V TGCA 5 cut(s) 44, 254, 724, 734, 924
HpyF10VI GCNNNNNNNGC 4 cut(s) 251, 320, 683, 881
HpyF3I CTNAG 6 cut(s) 588, 678, 712, 759, 819, 1061
HpySE526I ACGT 2 cut(s) 263, 957
Hsp92II CATG 3 cut(s) 487, 1048, 1057
KspAI GTTAAC 1 cut(s) 847
Kzo9I GATC 3 cut(s) 440, 542, 619
LmnI GCTCC 2 cut(s) 454, 470
Lsp1109I GCAGC 4 cut(s) 708, 718, 796, 875
LweI GCATC 1 cut(s) 753
MaeI CTAG 4 cut(s) 6, 540, 831, 1093
MaeII ACGT 2 cut(s) 263, 957
MaeIII GTNAC 2 cut(s) 643, 833
MalI GATC 3 cut(s) 442, 544, 621
MboI GATC 3 cut(s) 440, 542, 619
MboII GAAGA 2 cut(s) 551, 793
MflI RGATCY 2 cut(s) 440, 542
MhlI GDGCHC 5 cut(s) 288, 433, 475, 926, 947
MlsI TGGCCA 1 cut(s) 686
MluCI AATT 6 cut(s) 127, 357, 392, 514, 879, 937
MluNI TGGCCA 1 cut(s) 686
MlyI GAGTC 4 cut(s) 95, 286, 768, 1076
MmeI TCCRAC 1 cut(s) 206
MnlI CCTC 8 cut(s) 47, 67, 353, 590, 603, 620, 861, 1070
Mox20I TGGCCA 1 cut(s) 686
MscI TGGCCA 1 cut(s) 686
MseI TTAA 2 cut(s) 744, 846
Msp20I TGGCCA 1 cut(s) 686
MspA1I CMGCKG 1 cut(s) 677
MspI CCGG 4 cut(s) 291, 354, 1003, 1029
MspR9I CCNGG 2 cut(s) 143, 1087
MvaI CCWGG 2 cut(s) 143, 1087
MwoI GCNNNNNNNGC 4 cut(s) 251, 320, 683, 881
NdeI CATATG 1 cut(s) 859
NdeII GATC 3 cut(s) 440, 542, 619
NheI GCTAGC 1 cut(s) 5
NlaIII CATG 3 cut(s) 487, 1048, 1057
NlaIV GGNNCC 4 cut(s) 61, 313, 528, 793
NmeAIII GCCGAG 1 cut(s) 742
NmuCI GTSAC 2 cut(s) 643, 833
PagI TCATGA 1 cut(s) 483
PcsI WCGNNNNNNNCGW 1 cut(s) 695
PfeI GAWTC 3 cut(s) 257, 339, 974
PflFI GACNNNGTC 1 cut(s) 506
PfoI TCCNGGA 1 cut(s) 1085
PinAI ACCGGT 1 cut(s) 1002
PkrI GCNGC 5 cut(s) 497, 723, 733, 811, 890
PleI GAGTC 4 cut(s) 95, 285, 768, 1076
PpsI GAGTC 4 cut(s) 95, 285, 768, 1076
PpuMI RGGWCCY 2 cut(s) 899, 1089
Psp124BI GAGCTC 1 cut(s) 288
Psp5II RGGWCCY 2 cut(s) 899, 1089
Psp6I CCWGG 2 cut(s) 141, 1085
PspFI CCCAGC 2 cut(s) 63, 913
PspGI CCWGG 2 cut(s) 141, 1085
PspN4I GGNNCC 4 cut(s) 61, 313, 528, 793
PspPI GGNCC 5 cut(s) 34, 199, 656, 899, 1089
PspPPI RGGWCCY 2 cut(s) 899, 1089
PstI CTGCAG 1 cut(s) 736
PsuI RGATCY 2 cut(s) 440, 542
PsyI GACNNNGTC 1 cut(s) 506
PvuII CAGCTG 1 cut(s) 677
RsaI GTAC 4 cut(s) 386, 652, 697, 1007
RsaNI GTAC 4 cut(s) 385, 651, 696, 1006
SacI GAGCTC 1 cut(s) 288
SalI GTCGAC 2 cut(s) 110, 189
SaqAI TTAA 2 cut(s) 744, 846
SatI GCNGC 5 cut(s) 496, 722, 732, 810, 889
Sau3AI GATC 3 cut(s) 440, 542, 619
Sau96I GGNCC 5 cut(s) 34, 199, 656, 899, 1089
SchI GAGTC 4 cut(s) 95, 286, 768, 1076
ScrFI CCNGG 2 cut(s) 143, 1087
SduI GDGCHC 5 cut(s) 288, 433, 475, 926, 947
SfaNI GCATC 1 cut(s) 753
SfcI CTRYAG 2 cut(s) 732, 870
SinI GGWCC 4 cut(s) 34, 656, 899, 1089
SmlI CTYRAG 2 cut(s) 274, 852
SmoI CTYRAG 2 cut(s) 274, 852
Sse9I AATT 6 cut(s) 127, 357, 392, 514, 879, 937
SsiI CCGC 5 cut(s) 452, 468, 495, 749, 891
SspI AATATT 2 cut(s) 554, 1021
SspMI CTAG 4 cut(s) 6, 540, 831, 1093
SstI GAGCTC 1 cut(s) 288
StyD4I CCNGG 2 cut(s) 141, 1085
StyI CCWWGG 1 cut(s) 105
TaaI ACNGT 2 cut(s) 490, 704
TaiI ACGT 2 cut(s) 266, 960
TaqI TCGA 4 cut(s) 72, 111, 190, 573
TasI AATT 6 cut(s) 127, 357, 392, 514, 879, 937
TatI WGTACW 1 cut(s) 384
TauI GCSGC 1 cut(s) 498
TfiI GAWTC 3 cut(s) 257, 339, 974
Tru1I TTAA 2 cut(s) 744, 846
Tru9I TTAA 2 cut(s) 744, 846
TscAI CASTG 3 cut(s) 18, 46, 931
TseFI GTSAC 2 cut(s) 643, 833
TseI GCWGC 4 cut(s) 721, 731, 809, 888
Tsp45I GTSAC 2 cut(s) 643, 833
TspDTI ATGAA 6 cut(s) 223, 793, 966, 971, 1061, 1070
TspRI CASTG 3 cut(s) 18, 46, 931
Tth111I GACNNNGTC 1 cut(s) 506
VneI GTGCAC 1 cut(s) 922
VpaK11BI GGWCC 4 cut(s) 34, 656, 899, 1089
XapI RAATTY 1 cut(s) 357
XcmI CCANNNNNNNNNTGG 1 cut(s) 1075
XmiI GTMKAC 2 cut(s) 111, 190
XspI CTAG 4 cut(s) 6, 540, 831, 1093
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.