Rmu_co8311091.1_g000001

Dof zinc finger protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8311091.1
Physical Location & Seq
Reverse (-)
267 .. 896
630 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8311091.1_g000001.1.cds

Sequence Viewer

Length: 630 bp
ctgaaatgtccacgctgtgattcctcaaacaccaagttctgctactacaacaactacaatctgtcgcagcctcgccacttctgcaagaactgcaagaggtactggaccaaaggtggctccctcagaaacattccaataggcggtggaagcagaaagaacaccaagagatcgtcttcgggttcgaaacgctcttcatcggctactaattcctcatcatcaaccctgtcaagctcagcagctgcagttgcagcggcagcagcagctcagaaccaggatccgcagccggaccggactcggctctacggcccgaaaatggatccagataatccgatgctggatatttctgggagcttcagctcactgttaacatctaatgatcagtttgggtctcttatggagggtctgaatccaaatgggtcggggttgaaactgatgcaaatgggtgagtttggggagaatgtgatggattcatcaggacatgggttgaattcggatccgggtttggaggtccagagcagtgggaatccagggagctatatgggtttgcaaagtggggattcgagctgttggaatgggagcaatgggtggcctgaccttgccatttacacaccaggttcaagttttcagtag

Protein Analysis

209

Amino Acids

22.18

Weight (kDa)

8.75

Isoelectric Point (pI)

48.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013234)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 141, 251, 278
AclWI GGATC 6 cut(s) 269, 282, 311, 324, 488, 501
AcsI RAATTY 1 cut(s) 487
AcuI CTGAAG 1 cut(s) 337
AdeI CACNNNGTG 1 cut(s) 17
AfaI GTAC 1 cut(s) 101
AfiI CCNNNNNNNGG 2 cut(s) 140, 313
AgsI TTSAA 3 cut(s) 427, 487, 618
AjnI CCWGG 3 cut(s) 270, 526, 610
AluBI AGCT 7 cut(s) 231, 239, 263, 351, 357, 534, 564
AluI AGCT 7 cut(s) 231, 239, 263, 351, 357, 534, 564
Alw26I GTCTC 1 cut(s) 393
AlwI GGATC 6 cut(s) 269, 282, 311, 324, 488, 501
AlwNI CAGNNNCTG 1 cut(s) 239
AoxI GGCC 2 cut(s) 304, 587
ApeKI GCWGC 8 cut(s) 67, 236, 239, 248, 254, 257, 260, 280
ApoI RAATTY 1 cut(s) 487
AspS9I GGNCC 4 cut(s) 105, 286, 305, 508
AsuC2I CCSGG 1 cut(s) 498
AsuHPI GGTGA 1 cut(s) 455
AsuII TTCGAA 1 cut(s) 182
AvaII GGWCC 3 cut(s) 105, 286, 508
BamHI GGATCC 3 cut(s) 274, 316, 493
BbsI GAAGAC 1 cut(s) 165
BbvI GCAGC 8 cut(s) 79, 226, 248, 260, 266, 269, 272, 292
BccI CCATC 1 cut(s) 457
BceAI ACGGC 1 cut(s) 319
BciT130I CCWGG 3 cut(s) 272, 528, 612
BclI TGATCA 1 cut(s) 376
BcnI CCSGG 1 cut(s) 498
BcoDI GTCTC 1 cut(s) 393
BfmI CTRYAG 1 cut(s) 240
BisI GCNGC 9 cut(s) 68, 237, 240, 249, 252, 255, 258, 261, 281
BlpI GCTNAGC 1 cut(s) 232
BlsI GCNGC 9 cut(s) 69, 238, 241, 250, 253, 256, 259, 262, 282
Bme1390I CCNGG 4 cut(s) 272, 498, 528, 612
Bme18I GGWCC 3 cut(s) 105, 286, 508
BmgT120I GGNCC 4 cut(s) 105, 286, 305, 508
BmiI GGNNCC 4 cut(s) 118, 276, 318, 495
BmrFI CCNGG 4 cut(s) 272, 498, 528, 612
BmsI GCATC 2 cut(s) 321, 423
BpiI GAAGAC 1 cut(s) 165
Bpu1102I GCTNAGC 1 cut(s) 232
Bpu14I TTCGAA 1 cut(s) 182
BpuMI CCSGG 1 cut(s) 498
BsaI GGTCTC 1 cut(s) 393
BsaJI CCNNGG 1 cut(s) 527
BsaWI WCCGGW 1 cut(s) 288
Bsc4I CCNNNNNNNGG 2 cut(s) 140, 313
Bse1I ACTGG 1 cut(s) 107
Bse3DI GCAATG 1 cut(s) 586
BseBI CCWGG 3 cut(s) 272, 528, 612
BseDI CCNNGG 1 cut(s) 527
BseLI CCNNNNNNNGG 2 cut(s) 140, 313
BseMI GCAATG 1 cut(s) 586
BseMII CTCAG 3 cut(s) 136, 246, 278
BseNI ACTGG 1 cut(s) 107
BseXI GCAGC 8 cut(s) 79, 226, 248, 260, 266, 269, 272, 292
BshFI GGCC 2 cut(s) 306, 589
BsiSI CCGG 3 cut(s) 284, 289, 497
BslI CCNNNNNNNGG 2 cut(s) 140, 313
BsmAI GTCTC 1 cut(s) 393
BsnI GGCC 2 cut(s) 306, 589
Bso31I GGTCTC 1 cut(s) 393
Bsp119I TTCGAA 1 cut(s) 182
Bsp143I GATC 5 cut(s) 167, 274, 316, 376, 493
Bsp1720I GCTNAGC 1 cut(s) 232
BspACI CCGC 3 cut(s) 141, 251, 278
BspANI GGCC 2 cut(s) 306, 589
BspCNI CTCAG 3 cut(s) 135, 245, 277
BspLI GGNNCC 4 cut(s) 118, 276, 318, 495
BspMAI CTGCAG 1 cut(s) 244
BspPI GGATC 6 cut(s) 269, 282, 311, 324, 488, 501
BspQI GCTCTTC 1 cut(s) 196
BspT104I TTCGAA 1 cut(s) 182
BspTNI GGTCTC 1 cut(s) 393
BsrDI GCAATG 1 cut(s) 586
BsrI ACTGG 1 cut(s) 107
BssECI CCNNGG 1 cut(s) 527
BssMI GATC 5 cut(s) 167, 274, 316, 376, 493
Bst2UI CCWGG 3 cut(s) 272, 528, 612
Bst4CI ACNGT 1 cut(s) 363
Bst6I CTCTTC 1 cut(s) 196
BstAPI GCANNNNNTGC 1 cut(s) 90
BstBI TTCGAA 1 cut(s) 182
BstDEI CTNAG 3 cut(s) 122, 232, 264
BstKTI GATC 5 cut(s) 170, 277, 319, 379, 496
BstMAI GTCTC 1 cut(s) 393
BstMBI GATC 5 cut(s) 167, 274, 316, 376, 493
BstMWI GCNNNNNNNGC 8 cut(s) 81, 90, 147, 245, 248, 254, 257, 260
BstNI CCWGG 3 cut(s) 272, 528, 612
BstSCI CCNGG 4 cut(s) 270, 496, 526, 610
BstSFI CTRYAG 1 cut(s) 240
BstV1I GCAGC 8 cut(s) 79, 226, 248, 260, 266, 269, 272, 292
BstV2I GAAGAC 1 cut(s) 165
BstX2I RGATCY 3 cut(s) 274, 316, 493
BstXI CCANNNNNNTGG 1 cut(s) 518
BstYI RGATCY 3 cut(s) 274, 316, 493
BsuRI GGCC 2 cut(s) 306, 589
BtsI GCAGTG 1 cut(s) 523
BtsIMutI CAGTG 2 cut(s) 359, 523
CaiI CAGNNNCTG 1 cut(s) 239
Cfr13I GGNCC 4 cut(s) 105, 286, 305, 508
CpoI CGGWCCG 1 cut(s) 286
CsiI ACCWGGT 1 cut(s) 610
Csp6I GTAC 1 cut(s) 100
CspI CGGWCCG 1 cut(s) 286
CviAII CATG 1 cut(s) 479
CviQI GTAC 1 cut(s) 100
DdeI CTNAG 3 cut(s) 122, 232, 264
DpnI GATC 5 cut(s) 169, 276, 318, 378, 495
DpnII GATC 5 cut(s) 167, 274, 316, 376, 493
DraIII CACNNNGTG 1 cut(s) 17
Eam1104I CTCTTC 1 cut(s) 196
EarI CTCTTC 1 cut(s) 196
Eco31I GGTCTC 1 cut(s) 393
Eco47I GGWCC 3 cut(s) 105, 286, 508
Eco57I CTGAAG 1 cut(s) 337
EcoRI GAATTC 1 cut(s) 487
EcoRII CCWGG 3 cut(s) 270, 526, 610
FaeI CATG 1 cut(s) 482
FaiI YATR 4 cut(s) 395, 480, 537, 539
FatI CATG 1 cut(s) 478
FbaI TGATCA 1 cut(s) 376
Fnu4HI GCNGC 9 cut(s) 68, 237, 240, 249, 252, 255, 258, 261, 281
Fsp4HI GCNGC 9 cut(s) 68, 237, 240, 249, 252, 255, 258, 261, 281
GluI GCNGC 9 cut(s) 68, 237, 240, 249, 252, 255, 258, 261, 281
HaeIII GGCC 2 cut(s) 306, 589
HapII CCGG 3 cut(s) 284, 289, 497
Hin1II CATG 1 cut(s) 482
HincII GTYRAC 1 cut(s) 366
HindII GTYRAC 1 cut(s) 366
HinfI GANTC 6 cut(s) 20, 292, 406, 467, 523, 557
HpaI GTTAAC 1 cut(s) 366
HpaII CCGG 3 cut(s) 284, 289, 497
HphI GGTGA 1 cut(s) 455
Hpy166II GTNNAC 2 cut(s) 11, 366
Hpy188I TCNGA 5 cut(s) 125, 267, 330, 405, 493
Hpy188III TCNNGA 3 cut(s) 320, 474, 511
Hpy8I GTNNAC 2 cut(s) 11, 366
HpyCH4III ACNGT 1 cut(s) 363
HpyCH4V TGCA 6 cut(s) 84, 93, 242, 248, 436, 547
HpyF10VI GCNNNNNNNGC 8 cut(s) 81, 90, 147, 245, 248, 254, 257, 260
HpyF3I CTNAG 3 cut(s) 122, 232, 264
Hsp92II CATG 1 cut(s) 482
Ksp22I TGATCA 1 cut(s) 376
KspAI GTTAAC 1 cut(s) 366
Kzo9I GATC 5 cut(s) 167, 274, 316, 376, 493
LguI GCTCTTC 1 cut(s) 196
LmnI GCTCC 4 cut(s) 122, 348, 531, 576
Lsp1109I GCAGC 8 cut(s) 79, 226, 248, 260, 266, 269, 272, 292
LweI GCATC 2 cut(s) 321, 423
MabI ACCWGGT 1 cut(s) 610
MalI GATC 5 cut(s) 169, 276, 318, 378, 495
MboI GATC 5 cut(s) 167, 274, 316, 376, 493
MboII GAAGA 2 cut(s) 165, 183
MflI RGATCY 3 cut(s) 274, 316, 493
MluCI AATT 2 cut(s) 205, 487
MlyI GAGTC 1 cut(s) 286
MmeI TCCRAC 1 cut(s) 548
MnlI CCTC 7 cut(s) 34, 81, 90, 131, 220, 391, 499
MseI TTAA 1 cut(s) 365
MspA1I CMGCKG 2 cut(s) 239, 251
MspI CCGG 3 cut(s) 284, 289, 497
MspR9I CCNGG 4 cut(s) 272, 498, 528, 612
MvaI CCWGG 3 cut(s) 272, 528, 612
MwoI GCNNNNNNNGC 8 cut(s) 81, 90, 147, 245, 248, 254, 257, 260
NciI CCSGG 1 cut(s) 498
NdeII GATC 5 cut(s) 167, 274, 316, 376, 493
NlaIII CATG 1 cut(s) 482
NlaIV GGNNCC 4 cut(s) 118, 276, 318, 495
NmeAIII GCCGAG 1 cut(s) 274
NspV TTCGAA 1 cut(s) 182
PciSI GCTCTTC 1 cut(s) 196
PfeI GAWTC 5 cut(s) 20, 406, 467, 523, 557
PkrI GCNGC 9 cut(s) 69, 238, 241, 250, 253, 256, 259, 262, 282
PleI GAGTC 1 cut(s) 286
PpsI GAGTC 1 cut(s) 286
Psp6I CCWGG 3 cut(s) 270, 526, 610
PspGI CCWGG 3 cut(s) 270, 526, 610
PspN4I GGNNCC 4 cut(s) 118, 276, 318, 495
PspPI GGNCC 4 cut(s) 105, 286, 305, 508
PstI CTGCAG 1 cut(s) 244
PstNI CAGNNNCTG 1 cut(s) 239
PsuI RGATCY 3 cut(s) 274, 316, 493
PvuII CAGCTG 1 cut(s) 239
RsaI GTAC 1 cut(s) 101
RsaNI GTAC 1 cut(s) 100
Rsr2I CGGWCCG 1 cut(s) 286
RsrII CGGWCCG 1 cut(s) 286
SapI GCTCTTC 1 cut(s) 196
SaqAI TTAA 1 cut(s) 365
SatI GCNGC 9 cut(s) 68, 237, 240, 249, 252, 255, 258, 261, 281
Sau3AI GATC 5 cut(s) 167, 274, 316, 376, 493
Sau96I GGNCC 4 cut(s) 105, 286, 305, 508
SchI GAGTC 1 cut(s) 286
ScrFI CCNGG 4 cut(s) 272, 498, 528, 612
SexAI ACCWGGT 1 cut(s) 610
SfaNI GCATC 2 cut(s) 321, 423
SfcI CTRYAG 1 cut(s) 240
SfuI TTCGAA 1 cut(s) 182
SinI GGWCC 3 cut(s) 105, 286, 508
Sse9I AATT 2 cut(s) 205, 487
SsiI CCGC 3 cut(s) 141, 251, 278
StyD4I CCNGG 4 cut(s) 270, 496, 526, 610
TaaI ACNGT 1 cut(s) 363
TaqI TCGA 2 cut(s) 182, 560
TasI AATT 2 cut(s) 205, 487
TauI GCSGC 1 cut(s) 254
TfiI GAWTC 5 cut(s) 20, 406, 467, 523, 557
Tru1I TTAA 1 cut(s) 365
Tru9I TTAA 1 cut(s) 365
TscAI CASTG 2 cut(s) 366, 523
TseI GCWGC 8 cut(s) 67, 236, 239, 248, 254, 257, 260, 280
TspDTI ATGAA 2 cut(s) 183, 459
TspRI CASTG 2 cut(s) 366, 523
VpaK11BI GGWCC 3 cut(s) 105, 286, 508
XapI RAATTY 1 cut(s) 487
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.