Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8323751.1

Orthogroup ID

OG0005508

Physical Location & Seq

Genomic Coordinates Forward (+)

25 .. 779

Gene Structure 755 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8323751.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 558 bp

atggcaggagatacaatgattataaaaggagtgttcaggaggtatgaaaggtggaacccagtgcacccaacctctggagcattttggggtttgggaataggcattggttgtggtgttggatggggtcctggttttgggcctgaagtgattggctatgttggagctggctgtggtgttggcttcagtgttggtttcactctgcttggtgttggtattggtcttcctgccaattggctctacattgttccttatcaggctgttatggcagcaagaagtactgcattgaggcttggtagacctcctggtcttgttttctccaaaagtatagcaggagagggttgggataaaatagcaccgtgtgtcacagggctgcaaagagaagccagtggaagattgtctagcttcacacaacatcttgtggaaggggtcgagtcaattgatgtgaagagtcagctaagtgccaatagtaagaatgtttgtgatggtttaacagcgtttggtgaacgtatcttccactttcctaaaggtatggtcacacgtacaactagcagtagttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

185

Amino Acids

19.47

Weight (kDa)

9.23

Isoelectric Point (pI)

25.28

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005508)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G19070 AT4G19070
fragaria_vesca	FvH4_5g23880 FvH4_5g23880 FvH4_5g23880
malus_domestica	MD06G1014600.v1.1
prunus_persica	Prupe.5G021500_v2.0.a1 Prupe.5G021500_v2.0.a1 Prupe.5G021500_v2.0.a1 Prupe.5G021500_v2.0.a1
pyrus_communis	pycom06g01180
rosa_chinensis	RchiOBHm_Chr7g0213271
rosa_laevigata	RLG00000002816 RLG00000003095 RLG00000012098 RLG00000023533
rosa_multiflora	Rmu_co8323751.1_g000001 Rmu_sc0002226.1_g000016 Rmu_ssc0000084.1_g000027
rosa_roxburghii	Rroxscaffold_3G00246110
rosa_rugosa	Rorug07G0140900 Rorug07G0141000
rosa_samantha	Rh6BG340200 Rh6BG375900 Rh7AG272500 Rh7CG291900 Rh7DG280400
rosa_wichuraiana	Rw6G029030 Rw7G023660

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	23
AasI	GACNNNNNNGTC	1 cut(s)	303
AccB7I	CCANNNNNTGG	1 cut(s)	74
AccI	GTMKAC	1 cut(s)	295
AcuI	CTGAAG	2 cut(s)	162, 166
AdeI	CACNNNGTG	1 cut(s)	359
AfaI	GTAC	2 cut(s)	277, 541
AfiI	CCNNNNNNNGG	2 cut(s)	74, 134
AflIII	ACRYGT	1 cut(s)	536
AjnI	CCWGG	2 cut(s)	127, 301
AloI	GAACNNNNNNTCC	2 cut(s)	495, 527
AluBI	AGCT	3 cut(s)	164, 402, 454
AluI	AGCT	3 cut(s)	164, 402, 454
Alw21I	GWGCWC	1 cut(s)	66
Alw44I	GTGCAC	1 cut(s)	62
AoxI	GGCC	1 cut(s)	137
ApaLI	GTGCAC	1 cut(s)	62
ApeKI	GCWGC	2 cut(s)	266, 370
AspS9I	GGNCC	2 cut(s)	125, 137
AsuHPI	GGTGA	1 cut(s)	512
AvaII	GGWCC	1 cut(s)	125
BaeGI	GKGCMC	1 cut(s)	66
BbsI	GAAGAC	1 cut(s)	212
Bbv12I	GWGCWC	1 cut(s)	66
BbvI	GCAGC	2 cut(s)	278, 357
BccI	CCATC	2 cut(s)	114, 476
BciT130I	CCWGG	2 cut(s)	129, 303
BfaI	CTAG	2 cut(s)	399, 546
BisI	GCNGC	2 cut(s)	267, 371
BlsI	GCNGC	2 cut(s)	268, 372
BmcAI	AGTACT	1 cut(s)	277
Bme1390I	CCNGG	2 cut(s)	129, 303
Bme18I	GGWCC	1 cut(s)	125
BmgT120I	GGNCC	2 cut(s)	125, 137
BmiI	GGNNCC	2 cut(s)	56, 126
BmrFI	CCNGG	2 cut(s)	129, 303
BmrI	ACTGGG	1 cut(s)	53
BmuI	ACTGGG	1 cut(s)	53
BpiI	GAAGAC	1 cut(s)	212
BpmI	CTGGAG	1 cut(s)	96
BsaAI	YACGTR	1 cut(s)	539
Bsc4I	CCNNNNNNNGG	2 cut(s)	74, 134
Bse1I	ACTGG	2 cut(s)	59, 384
BseBI	CCWGG	2 cut(s)	129, 303
BseGI	GGATG	1 cut(s)	125
BseLI	CCNNNNNNNGG	2 cut(s)	74, 134
BseNI	ACTGG	2 cut(s)	59, 384
BseSI	GKGCMC	1 cut(s)	66
BseXI	GCAGC	2 cut(s)	278, 357
BshFI	GGCC	1 cut(s)	139
BsiHKAI	GWGCWC	1 cut(s)	66
BslI	CCNNNNNNNGG	2 cut(s)	74, 134
BsnI	GGCC	1 cut(s)	139
Bsp1286I	GDGCHC	1 cut(s)	66
BspANI	GGCC	1 cut(s)	139
BspLI	GGNNCC	2 cut(s)	56, 126
BsrI	ACTGG	2 cut(s)	59, 384
Bst2UI	CCWGG	2 cut(s)	129, 303
Bst4CI	ACNGT	1 cut(s)	357
Bst6I	CTCTTC	1 cut(s)	440
BstBAI	YACGTR	1 cut(s)	539
BstC8I	GCNNGC	1 cut(s)	166
BstDEI	CTNAG	1 cut(s)	455
BstF5I	GGATG	1 cut(s)	125
BstMWI	GCNNNNNNNGC	1 cut(s)	263
BstNI	CCWGG	2 cut(s)	129, 303
BstSCI	CCNGG	2 cut(s)	127, 301
BstSLI	GKGCMC	1 cut(s)	66
BstV1I	GCAGC	2 cut(s)	278, 357
BstV2I	GAAGAC	1 cut(s)	212
BsuRI	GGCC	1 cut(s)	139
BtsCI	GGATG	1 cut(s)	125
BtsIMutI	CAGTG	3 cut(s)	66, 190, 391
Cac8I	GCNNGC	1 cut(s)	166
Cfr13I	GGNCC	2 cut(s)	125, 137
Csp6I	GTAC	2 cut(s)	276, 540
CviQI	GTAC	2 cut(s)	276, 540
DdeI	CTNAG	1 cut(s)	455
DraIII	CACNNNGTG	1 cut(s)	359
DrdI	GACNNNNNNGTC	1 cut(s)	303
DseDI	GACNNNNNNGTC	1 cut(s)	303
Eam1104I	CTCTTC	1 cut(s)	440
EarI	CTCTTC	1 cut(s)	440
Eco47I	GGWCC	1 cut(s)	125
Eco57I	CTGAAG	2 cut(s)	162, 166
EcoO109I	RGGNCCY	1 cut(s)	125
EcoRII	CCWGG	2 cut(s)	127, 301
FaiI	YATR	6 cut(s)	23, 45, 156, 263, 326, 530
FblI	GTMKAC	1 cut(s)	295
Fnu4HI	GCNGC	2 cut(s)	267, 371
FokI	GGATG	1 cut(s)	132
Fsp4HI	GCNGC	2 cut(s)	267, 371
FspBI	CTAG	2 cut(s)	399, 546
GluI	GCNGC	2 cut(s)	267, 371
GsuI	CTGGAG	1 cut(s)	96
HaeIII	GGCC	1 cut(s)	139
HinfI	GANTC	2 cut(s)	431, 448
HphI	GGTGA	1 cut(s)	512
Hpy166II	GTNNAC	3 cut(s)	64, 296, 503
Hpy188III	TCNNGA	2 cut(s)	37, 75
Hpy8I	GTNNAC	3 cut(s)	64, 296, 503
HpyAV	CCTTC	1 cut(s)	416
HpyCH4III	ACNGT	1 cut(s)	357
HpyCH4IV	ACGT	2 cut(s)	505, 538
HpyCH4V	TGCA	3 cut(s)	64, 281, 373
HpyF10VI	GCNNNNNNNGC	1 cut(s)	263
HpyF3I	CTNAG	1 cut(s)	455
HpySE526I	ACGT	2 cut(s)	505, 538
LmnI	GCTCC	2 cut(s)	77, 161
Lsp1109I	GCAGC	2 cut(s)	278, 357
MaeI	CTAG	2 cut(s)	399, 546
MaeII	ACGT	2 cut(s)	505, 538
MaeIII	GTNAC	2 cut(s)	361, 532
MboII	GAAGA	4 cut(s)	212, 402, 457, 502
MfeI	CAATTG	2 cut(s)	229, 435
MhlI	GDGCHC	1 cut(s)	66
MluCI	AATT	2 cut(s)	229, 435
MlyI	GAGTC	2 cut(s)	440, 457
MmeI	TCCRAC	2 cut(s)	97, 139
MnlI	CCTC	5 cut(s)	33, 82, 279, 309, 328
MseI	TTAA	2 cut(s)	488, 556
MspR9I	CCNGG	2 cut(s)	129, 303
MunI	CAATTG	2 cut(s)	229, 435
MvaI	CCWGG	2 cut(s)	129, 303
MwoI	GCNNNNNNNGC	1 cut(s)	263
NlaIV	GGNNCC	2 cut(s)	56, 126
NmuCI	GTSAC	2 cut(s)	361, 532
PflMI	CCANNNNNTGG	1 cut(s)	74
PkrI	GCNGC	2 cut(s)	268, 372
PleI	GAGTC	2 cut(s)	439, 456
PpsI	GAGTC	2 cut(s)	439, 456
Ppu21I	YACGTR	1 cut(s)	539
PpuMI	RGGWCCY	1 cut(s)	125
PsiI	TTATAA	1 cut(s)	23
Psp5II	RGGWCCY	1 cut(s)	125
Psp6I	CCWGG	2 cut(s)	127, 301
PspGI	CCWGG	2 cut(s)	127, 301
PspN4I	GGNNCC	2 cut(s)	56, 126
PspPI	GGNCC	2 cut(s)	125, 137
PspPPI	RGGWCCY	1 cut(s)	125
RsaI	GTAC	2 cut(s)	277, 541
RsaNI	GTAC	2 cut(s)	276, 540
SaqAI	TTAA	2 cut(s)	488, 556
SatI	GCNGC	2 cut(s)	267, 371
Sau96I	GGNCC	2 cut(s)	125, 137
ScaI	AGTACT	1 cut(s)	277
SchI	GAGTC	2 cut(s)	440, 457
ScrFI	CCNGG	2 cut(s)	129, 303
SduI	GDGCHC	1 cut(s)	66
SinI	GGWCC	1 cut(s)	125
Sse9I	AATT	2 cut(s)	229, 435
SspMI	CTAG	2 cut(s)	399, 546
StyD4I	CCNGG	2 cut(s)	127, 301
TaaI	ACNGT	1 cut(s)	357
TaiI	ACGT	2 cut(s)	508, 541
TaqI	TCGA	1 cut(s)	429
TasI	AATT	2 cut(s)	229, 435
TatI	WGTACW	1 cut(s)	275
Tru1I	TTAA	2 cut(s)	488, 556
Tru9I	TTAA	2 cut(s)	488, 556
TscAI	CASTG	3 cut(s)	66, 190, 391
TseFI	GTSAC	2 cut(s)	361, 532
TseI	GCWGC	2 cut(s)	266, 370
Tsp45I	GTSAC	2 cut(s)	361, 532
TspDTI	ATGAA	1 cut(s)	60
TspRI	CASTG	3 cut(s)	66, 190, 391
Van91I	CCANNNNNTGG	1 cut(s)	74
VneI	GTGCAC	1 cut(s)	62
VpaK11BI	GGWCC	1 cut(s)	125
XmiI	GTMKAC	1 cut(s)	295
XspI	CTAG	2 cut(s)	399, 546
ZrmI	AGTACT	1 cut(s)	277

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.