Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000084.1

Orthogroup ID

OG0005508

Physical Location & Seq

Genomic Coordinates Reverse (-)

129909 .. 133228

Gene Structure 3320 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000084.1_g000027.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 654 bp

atgatgacgatggagattgaggtgttctggaggaggagattgaggtgtcctggaggaagagctttgttagtgtccaatagttcacttcaaagaggaagaacgaccagagctcacatcacaggagatacaatgattataaaaggagtgttcaggaggtatgaaaggtggaacccagtgcacccaacctctggagcattttggggtttgggaataggcattggttgtggtgttggatggggtcctggttttgggcctgaagtgattggctatgttggagctggctgtggtgttggcttcagtgttggtttcactctgcttggtgttggtattggtcttcctgccaattggctctacattgttccttatcaggctgttatggcagcaagaagtactgcattgaggcttggtagacctcctggtcttgttttctccaaaagtatagcaggagagggttgggataaaatagcaccgtgtgtcacagggctgcaaagagaagccagtggaagattgtctagcttcacacaacatcttgtggaaggggtcgagtcaattgatgtgaagagtcagctaagtgccaatagtaagaatgtttgtgatggtttaacagcgtttggtgaacgtatcttccactttcctaaaggttccaaagattga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

217

Amino Acids

23.32

Weight (kDa)

9.84

Isoelectric Point (pI)

34.59

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005508)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G19070 AT4G19070
fragaria_vesca	FvH4_5g23880 FvH4_5g23880 FvH4_5g23880
malus_domestica	MD06G1014600.v1.1
prunus_persica	Prupe.5G021500_v2.0.a1 Prupe.5G021500_v2.0.a1 Prupe.5G021500_v2.0.a1 Prupe.5G021500_v2.0.a1
pyrus_communis	pycom06g01180
rosa_chinensis	RchiOBHm_Chr7g0213271
rosa_laevigata	RLG00000002816 RLG00000003095 RLG00000012098 RLG00000023533
rosa_multiflora	Rmu_co8323751.1_g000001 Rmu_sc0002226.1_g000016 Rmu_ssc0000084.1_g000027
rosa_roxburghii	Rroxscaffold_3G00246110
rosa_rugosa	Rorug07G0140900 Rorug07G0141000
rosa_samantha	Rh6BG340200 Rh6BG375900 Rh7AG272500 Rh7CG291900 Rh7DG280400
rosa_wichuraiana	Rw6G029030 Rw7G023660

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	137
AasI	GACNNNNNNGTC	1 cut(s)	417
AccB7I	CCANNNNNTGG	1 cut(s)	188
AccI	GTMKAC	1 cut(s)	409
AcuI	CTGAAG	2 cut(s)	276, 280
AdeI	CACNNNGTG	1 cut(s)	473
AfaI	GTAC	1 cut(s)	391
AfiI	CCNNNNNNNGG	2 cut(s)	188, 248
AgsI	TTSAA	1 cut(s)	89
AjnI	CCWGG	3 cut(s)	49, 241, 415
AloI	GAACNNNNNNTCC	2 cut(s)	609, 641
AluBI	AGCT	5 cut(s)	62, 110, 278, 516, 568
AluI	AGCT	5 cut(s)	62, 110, 278, 516, 568
Alw21I	GWGCWC	2 cut(s)	112, 180
Alw44I	GTGCAC	1 cut(s)	176
AoxI	GGCC	1 cut(s)	251
ApaLI	GTGCAC	1 cut(s)	176
ApeKI	GCWGC	2 cut(s)	380, 484
AspS9I	GGNCC	2 cut(s)	239, 251
AsuHPI	GGTGA	1 cut(s)	626
AvaII	GGWCC	1 cut(s)	239
BaeGI	GKGCMC	1 cut(s)	180
BanII	GRGCYC	1 cut(s)	112
BbsI	GAAGAC	1 cut(s)	326
Bbv12I	GWGCWC	2 cut(s)	112, 180
BbvI	GCAGC	2 cut(s)	392, 471
BccI	CCATC	3 cut(s)	4, 228, 590
BciT130I	CCWGG	3 cut(s)	51, 243, 417
BfaI	CTAG	1 cut(s)	513
BisI	GCNGC	2 cut(s)	381, 485
BlsI	GCNGC	2 cut(s)	382, 486
BmcAI	AGTACT	1 cut(s)	391
Bme1390I	CCNGG	3 cut(s)	51, 243, 417
Bme18I	GGWCC	1 cut(s)	239
BmgT120I	GGNCC	2 cut(s)	239, 251
BmiI	GGNNCC	3 cut(s)	170, 240, 643
BmrFI	CCNGG	3 cut(s)	51, 243, 417
BmrI	ACTGGG	1 cut(s)	167
BmuI	ACTGGG	1 cut(s)	167
BpiI	GAAGAC	1 cut(s)	326
BpmI	CTGGAG	3 cut(s)	49, 72, 210
Bsc4I	CCNNNNNNNGG	2 cut(s)	188, 248
Bse1I	ACTGG	2 cut(s)	173, 498
BseBI	CCWGG	3 cut(s)	51, 243, 417
BseGI	GGATG	1 cut(s)	239
BseLI	CCNNNNNNNGG	2 cut(s)	188, 248
BseNI	ACTGG	2 cut(s)	173, 498
BseRI	GAGGAG	2 cut(s)	46, 49
BseSI	GKGCMC	1 cut(s)	180
BseXI	GCAGC	2 cut(s)	392, 471
BshFI	GGCC	1 cut(s)	253
BsiHKAI	GWGCWC	2 cut(s)	112, 180
BslI	CCNNNNNNNGG	2 cut(s)	188, 248
BsnI	GGCC	1 cut(s)	253
Bsp1286I	GDGCHC	2 cut(s)	112, 180
BspANI	GGCC	1 cut(s)	253
BspLI	GGNNCC	3 cut(s)	170, 240, 643
BspQI	GCTCTTC	1 cut(s)	52
BsrI	ACTGG	2 cut(s)	173, 498
Bst2UI	CCWGG	3 cut(s)	51, 243, 417
Bst4CI	ACNGT	1 cut(s)	471
Bst6I	CTCTTC	2 cut(s)	52, 554
BstC8I	GCNNGC	1 cut(s)	280
BstDEI	CTNAG	1 cut(s)	569
BstF5I	GGATG	1 cut(s)	239
BstMWI	GCNNNNNNNGC	1 cut(s)	377
BstNI	CCWGG	3 cut(s)	51, 243, 417
BstSCI	CCNGG	3 cut(s)	49, 241, 415
BstSLI	GKGCMC	1 cut(s)	180
BstV1I	GCAGC	2 cut(s)	392, 471
BstV2I	GAAGAC	1 cut(s)	326
BsuRI	GGCC	1 cut(s)	253
BtsCI	GGATG	1 cut(s)	239
BtsIMutI	CAGTG	3 cut(s)	180, 304, 505
Cac8I	GCNNGC	1 cut(s)	280
Cfr13I	GGNCC	2 cut(s)	239, 251
Csp6I	GTAC	1 cut(s)	390
CviQI	GTAC	1 cut(s)	390
DdeI	CTNAG	1 cut(s)	569
DraIII	CACNNNGTG	1 cut(s)	473
DrdI	GACNNNNNNGTC	1 cut(s)	417
DseDI	GACNNNNNNGTC	1 cut(s)	417
Eam1104I	CTCTTC	2 cut(s)	52, 554
EarI	CTCTTC	2 cut(s)	52, 554
Ecl136II	GAGCTC	1 cut(s)	110
Eco24I	GRGCYC	1 cut(s)	112
Eco47I	GGWCC	1 cut(s)	239
Eco53kI	GAGCTC	1 cut(s)	110
Eco57I	CTGAAG	2 cut(s)	276, 280
EcoICRI	GAGCTC	1 cut(s)	110
EcoO109I	RGGNCCY	1 cut(s)	239
EcoRII	CCWGG	3 cut(s)	49, 241, 415
EcoT38I	GRGCYC	1 cut(s)	112
FaiI	YATR	5 cut(s)	137, 159, 270, 377, 440
FblI	GTMKAC	1 cut(s)	409
Fnu4HI	GCNGC	2 cut(s)	381, 485
FokI	GGATG	1 cut(s)	246
FriOI	GRGCYC	1 cut(s)	112
Fsp4HI	GCNGC	2 cut(s)	381, 485
FspBI	CTAG	1 cut(s)	513
GluI	GCNGC	2 cut(s)	381, 485
GsuI	CTGGAG	3 cut(s)	49, 72, 210
HaeIII	GGCC	1 cut(s)	253
HinfI	GANTC	2 cut(s)	545, 562
HphI	GGTGA	1 cut(s)	626
Hpy166II	GTNNAC	4 cut(s)	83, 178, 410, 617
Hpy188III	TCNNGA	3 cut(s)	28, 151, 189
Hpy8I	GTNNAC	4 cut(s)	83, 178, 410, 617
HpyAV	CCTTC	1 cut(s)	530
HpyCH4III	ACNGT	1 cut(s)	471
HpyCH4IV	ACGT	1 cut(s)	619
HpyCH4V	TGCA	3 cut(s)	178, 395, 487
HpyF10VI	GCNNNNNNNGC	1 cut(s)	377
HpyF3I	CTNAG	1 cut(s)	569
HpySE526I	ACGT	1 cut(s)	619
LguI	GCTCTTC	1 cut(s)	52
LmnI	GCTCC	2 cut(s)	191, 275
Lsp1109I	GCAGC	2 cut(s)	392, 471
MaeI	CTAG	1 cut(s)	513
MaeII	ACGT	1 cut(s)	619
MaeIII	GTNAC	1 cut(s)	475
MboII	GAAGA	6 cut(s)	69, 108, 326, 516, 571, 616
MfeI	CAATTG	2 cut(s)	343, 549
MhlI	GDGCHC	2 cut(s)	112, 180
MluCI	AATT	2 cut(s)	343, 549
MlyI	GAGTC	2 cut(s)	554, 571
MmeI	TCCRAC	2 cut(s)	211, 253
MseI	TTAA	1 cut(s)	602
MspR9I	CCNGG	3 cut(s)	51, 243, 417
MunI	CAATTG	2 cut(s)	343, 549
MvaI	CCWGG	3 cut(s)	51, 243, 417
MwoI	GCNNNNNNNGC	1 cut(s)	377
NlaIV	GGNNCC	3 cut(s)	170, 240, 643
NmuCI	GTSAC	1 cut(s)	475
PciSI	GCTCTTC	1 cut(s)	52
PflMI	CCANNNNNTGG	1 cut(s)	188
PfoI	TCCNGGA	1 cut(s)	49
PkrI	GCNGC	2 cut(s)	382, 486
PleI	GAGTC	2 cut(s)	553, 570
PpsI	GAGTC	2 cut(s)	553, 570
PpuMI	RGGWCCY	1 cut(s)	239
PsiI	TTATAA	1 cut(s)	137
Psp124BI	GAGCTC	1 cut(s)	112
Psp5II	RGGWCCY	1 cut(s)	239
Psp6I	CCWGG	3 cut(s)	49, 241, 415
PspGI	CCWGG	3 cut(s)	49, 241, 415
PspN4I	GGNNCC	3 cut(s)	170, 240, 643
PspPI	GGNCC	2 cut(s)	239, 251
PspPPI	RGGWCCY	1 cut(s)	239
RsaI	GTAC	1 cut(s)	391
RsaNI	GTAC	1 cut(s)	390
SacI	GAGCTC	1 cut(s)	112
SapI	GCTCTTC	1 cut(s)	52
SaqAI	TTAA	1 cut(s)	602
SatI	GCNGC	2 cut(s)	381, 485
Sau96I	GGNCC	2 cut(s)	239, 251
ScaI	AGTACT	1 cut(s)	391
SchI	GAGTC	2 cut(s)	554, 571
ScrFI	CCNGG	3 cut(s)	51, 243, 417
SduI	GDGCHC	2 cut(s)	112, 180
SinI	GGWCC	1 cut(s)	239
Sse9I	AATT	2 cut(s)	343, 549
SspMI	CTAG	1 cut(s)	513
SstI	GAGCTC	1 cut(s)	112
StyD4I	CCNGG	3 cut(s)	49, 241, 415
TaaI	ACNGT	1 cut(s)	471
TaiI	ACGT	1 cut(s)	622
TaqI	TCGA	1 cut(s)	543
TasI	AATT	2 cut(s)	343, 549
TatI	WGTACW	1 cut(s)	389
Tru1I	TTAA	1 cut(s)	602
Tru9I	TTAA	1 cut(s)	602
TscAI	CASTG	3 cut(s)	180, 304, 505
TseFI	GTSAC	1 cut(s)	475
TseI	GCWGC	2 cut(s)	380, 484
Tsp45I	GTSAC	1 cut(s)	475
TspDTI	ATGAA	1 cut(s)	174
TspRI	CASTG	3 cut(s)	180, 304, 505
Van91I	CCANNNNNTGG	1 cut(s)	188
VneI	GTGCAC	1 cut(s)	176
VpaK11BI	GGWCC	1 cut(s)	239
XmiI	GTMKAC	1 cut(s)	409
XspI	CTAG	1 cut(s)	513
ZrmI	AGTACT	1 cut(s)	391

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.